INTRODUCTION:

One of the serious metabolic illness Diabetes Mellitus (DM) is indicated by hyperglycemia due to impaired insulin secretion in the body¹. This impairment in carbohydrate, protein, and lipid metabolism reduces tissue sensitivity to insulin². DM ranks among the most prevalent and significant chronic disorders³, categorized mainly into insulin dependent (type-1) and non-insulin dependent (type-2) diabetes mellitus⁴.

Damage to the smaller arterioles and venules due to higher blood glucose levels causes complications that include retinopathy, neuropathy, and nephropathy⁵. Diabetic nephropathy (DN) is a long-term complication of diabetes leading to end-stage renal disease, occurring in both type-1 and type-2 diabetes and other forms of DM. The risk of developing DN is roughly around 30% to 40% among subjects with both type-1 and type-2 diabetes⁶. Microalbuminuria serves as an indicator of renal involvement in diabetic patients⁷. Early DN stages are defined by a decrease in glomerular filtration rate and an increase in urine albumin excretion and decreased glomerular filtration rate. This proteinuria stems from podocyte injury, increase in the thickness of the basement membrane of glomerulus (GBM), and renal fibrosis⁸, with podocyte damage considered a critical factor in DN onset, disrupting cellular metabolic regulation⁹. DN reduces life expectancy, diminishes standard of living, and stands as a primary cause of mortality and morbidity¹⁰. Diabetic patients with nephropathy face heightened risks of cardiovascular diseases, with higher mortality rates compared to those without nephropathy¹¹. Kidneys are susceptible to oxidative stress, with various studies identifying reactive oxygen species as crucial mediators in DN pathogenesis¹². Polygenic factors strongly correlate with DN, with familial clustering evident across Caucasian and non-Caucasian populations. Despite numerous studies, the etiology of DN remains complex¹³, with both genetic and environmental factors independently or jointly influencing DN onset and progression¹⁴.

The Sirtuin family belongs to the nicotinamide adenine dinucleotide (NAD+)-dependent deacetylase, regulating intracellular transcriptional activity. Their molecular structure is composed of the Rossmann-fold domain, which is characteristic of NAD+/NADH binding proteins, and a catalytic core domain made up of about 275 amino acid sequences that connects the zinc-binding domain by several loops¹⁵. Acetylation and deacetylation processes govern various cellular functions such as cell proliferation, autophagy, apoptosis, inflammation, and oxidative stress. Silent information regulator 2 is one of the mammalian histone deacetylases that uses the coenzyme NAD+ to deacetylate lysine residues on both histone and non-histone proteins¹⁶.

Sirtuins, classified into 1 to 7 based on intracellular localization and affinity to bind different acetylated protein substrates, play crucial roles. Sirtuin 1 (SIRT1), extensively studied, is found in both the cytoplasm and nucleus¹⁷. SIRT1 is expressed in liver, kidney, muscle, pancreas, and adipose tissues, modifying proteins involved in deoxyribose nucleic acid repair, inflammatory responses and stress¹⁵. In diabetes and associated complications, SIRT1 suppresses inflammatory pathways, gene expression, and secretion of pro-inflammatory molecules^18,19. Additionally, SIRT1 exhibits renoprotective effects by preventing tubular and glomerular cell apoptosis, conferring resistance to cellular stress, inducing autophagy, and regulating renal lipid metabolism and blood presure²⁰.

SIRT1 gene, located on chromosome 10, is one of seven SIRT genes found in mammals, each encoding a distinct SIRT enzyme¹⁵. Polymorphisms in the SIRT1 gene play a crucial part in or affect different processes that includes inflammation, type-2 diabetes, obesity, heart related diseases, cancer, and neurodegenerative diseases²¹. In our study, we examined the pattern of the Silent Mating Type Information Regulator 1 Homologue 2 gene and investigated polymorphism of SIRT1 rs3740051, along with sirtuin 1 serum level, in T2DM subjects with or without nephropathy.

STUDY AIMS:

To find the significance of sirtuin 1 serum levels and polymorphism of SIRT1 gene in the context of diabetic nephropathy.

OBJECTIVES:

1. To compare serum sirtuin 1 level between T2DM patients and DN patients.

2. To assess the polymorphism of the SIRT 1 gene in patients with T2DM with or without diabetic nephropathy.

3. To observe the relationship of SIRT1 gene polymorphism with serum sirtuin 1 levels in DN patients.

4. Evaluate association of SIRT1 gene polymorphism and sirtuin 1 serum levels in various stages of DN patients.

METHODOLOGY:

For this analytical prospective study, 108 diabetic subjects diagnosed with T2DM without any complications according to the American Diabetes Association criteria, and without microalbuminuria, were included as the control group. Additionally, 108 diabetic nephropathy patients were included as the case group depending on microprotein test. This study rules out recruiting subjects with non-benign conditions, infectious kidney conditions, other nephropathy condition and medically identified chronic kidney disease, Lupus nephritis, and AKI. Data collection occurred from May 2021 to April 2023 following Central Ethics Committee approval. For each subject, written informed permission was obtained. The study held at the Department of Medicine, Justice KS Hegde Charitable Hospital, in collaboration with the KSHEMA research laboratory, Mangalore, India. Demographic details including age, sex, BMI, span of diabetes, family history of diabetes, smoking status, blood pressure, antidiabetic medications, other long-standing complications of type-2 diabetes (diabetic retinopathy and diabetic foot), and lipid profiles were collected.

Staging of DN based on microalbuminuria is A2 that is ranged between 30-300mg/g and A3 stage which is more than 300mg/g: eGFR based classification as follows: Stage 1 in which eGFR is >90ml/min; Stage 2 – eGFR is 60-89ml/min; Stage 3 where eGFR is 45-59ml/min; Stage 4 – eGFR is 30-44ml/min; Stage 5 in which eGFR is 15-29ml/min; Stage 6 where in eGFR is <15ml/min. These stages are called as G1, G2, G3a, G3b, G4 and G5 respectively.

Genotyping technique:

PCR-RFLP method was employed for SIRT1 genotyping. Genomic DNA extraction was performed using 5 milliliters of fasting venous blood. Three milliliters of whole blood were centrifuged at 25°C for about ten minutes to extract serum. Then, stored at -80°C for serum sirtuin 1 level analysis. Two milliliters of EDTA whole blood were used for genomic DNA extraction using the phenol-chloroform and ethanol precipitation methods. Polymorphism of SIRT1 was conducted using the PCR-RFLP method, targeting the rs3740051 SNP. The sequence of the primers used were: upstream primer 5’ GCTCACGCTAGAAAGGAAGGA 3’ and downstream primer 5’ GGGCCAGACCACAACACTA 3’. DNA amplification was conducted in an MJ-Mini Thermal cycler with denaturation at 95°C for 10 minutes, followed by 35 cycles of amplification at 95°C about 30 seconds, annealing at a specific temperature for 30 seconds, and final extension at 72°C for 5 minutes. The restriction enzyme HPA1 was applied to digest the PCR product, and the fragments resulted were separated on a 2% agarose gel with ethidium bromide. Based on digestion patterns obtained, the genotypes were labelled.

Sample Size:

The total sample size was 216, including 108 case and 108 control patients.

Analysis of the obtained results:

SPSS 21.0 software was used to analyze the data obtained and the results were tabulated. Qualitative data were expressed as frequency and percentage, while quantitative data were presented as mean±SD or median (IQR). The association between gene polymorphism and serum sirtuin levels was assessed using the chi-square test, with a p-value <0.05 considered statistically significant.

RESULTS:

The comparison of demographic parameters among T2DM subjects and DN subjects revealed several noteworthy findings (table 1). Firstly, statistically significant age difference existed between the two groups, with diabetic nephropathy patients being slightly older on average. However, no significant difference was observed in BMI between the two groups. The duration of diabetes was significantly longer in diabetic nephropathy patients compared to type-2 diabetic patients without nephropathy. While the family history of diabetes between the two groups did not show any significance, the proportion of smokers was much higher among DN subjects compared to T2DM subjects. Additionally, there was a slightly higher proportion of males among diabetic nephropathy patients compared to type-2 diabetic patients, although this difference was not statistically significant at the conventional level.

Table 1: Demographic characteristics observed in the study subjects

Demographic features	T2DM subjects	DN subjects	p-value
Age (years)	55.64±8.88	57.82±7.86	0.048*
Gender: Male Females	68 40	81 27	0.05
BMI (Kg/m²)	22.46±2.22	22.26±2.88	0.570
Duration of diabetes (years)	10 (5, 12)	15 (10.25, 20)	<0.0001**
History of diabetes: Yes No	57 51	47 61	0.173
Smoking status: Smokers Non-smokers	84 24	69 39	0.025*

Table 2: displays the biochemical investigations observed in both T2DM and DN subjects. Among these, significant differences were found in serum creatinine, blood urea and albumin levels between the two groups. Specifically, diabetic nephropathy patients exhibited markedly higher levels of blood urea and serum creatinine, indicating impaired kidney function, along with lower levels of albumin compared to type-2 diabetic patients without nephropathy. However, no significant differences were observed in HbA1c, FBS levels between the two groups.

Table 2: Comparison of biochemical aspects among cases and controls

Biochemical investigation	T2DM subjects	DN subjects	p-value
Glycated Hb(g%)	8.76±2.02	8.31±2.17	0.118
FBS (mmol/l)	9.44±2.67	172.33±47.18	0.711
Blood urea(mmol/l)	4.48 (3.54, 6.33)	9.59 (7.31, 13.7)	<0.0001***
Serum creatinine (mg/dl)	0.92 (0.71, 1.19)	1.6 (1.2, 4.11)	<0.0001***
Albumin(g/dl)	4.15±0.49	3.40±0.67	0.000**

Ordinal central tendency test (non-parametric test and unpaired T test) p<0.0001 is considered highly significant.

Table 3 presents the sirtuin 1 serum level observed in patients with and without nephropathy. A statistically significant difference was found between the two groups, with diabetic nephropathy patients exhibiting lower serum sirtuin 1 level compared to T2DM and DN subjects.

Table 3: Sirtuin 1 levels comparison among the cases and controls

Groups	Serum levels of sirtuin 1 (ng/ml)	p-value
Cases	2.12 (2.05, 2.27)	0.000**
Controls	2.53 (2.28, 2.77)	0.000**

The test applied is Mann Whitney, p = 0.000, significant

An ROC curve was generated using the serum sirtuin 1 levels of both the case and control groups (Fig 1). From this analysis, a cut-off value of 2.187 ng/ml was determined based on sensitivity and specificity values. Using this cut-off value, the association of genotypes with different stages of diabetic nephropathy (DN) was investigated. Calculated area under the curve value was 0.797, indicating that serum sirtuin 1 level serves as a reliable biomarker for predicting diabetic nephropathy when compared to the control group.

Fig. 1: ROC curve of SIRTUIN 1 levels in the serum

Table 4 illustrates the distribution of SIRT1 genotypes among patients with and without nephropathy. In the control group, the most prevalent genotype was AA, with 84 individuals exhibiting this genotype. This was followed by the AG genotype, present in 23 individuals, and the GG genotype, observed in only one individual. Conversely, among patients with nephropathy, the AA genotype was also the most common, with 98 individuals having this genotype. However, the distribution of genotypes differed slightly, with fewer individuals having the AG genotype (6 individuals) and the GG genotype (4 individuals) compared to the control group. Overall, the data indicates a variation in SIRT1 genotypes between patients with and without nephropathy.

Table 4: SIRT 1 genotype pattern observed between the patients with or without nephropathy

Genotype	T2DM subjects	DN subjects
AA	84	98
AG	23	06
GG	01	04

Fig 2: Genotypic pattern of SIRT1

Table 5 presents the results of the frequency distribution test for the SIRT1 gene, specifically assessing Hardy-Weinberg equilibrium (HWE). The table includes the actual and expected values for each genotype (AA, AG, GG) along with the corresponding p-values. For the AA genotype, the observed and expected values suggest a significant deviation from HWE. Similarly, for the GG genotype, the observed and expected values also indicate a significant deviation from HWE. Overall, the results suggest that there is a deviation from HWE for at least one of the genotypes analyzed, indicating potential genetic factors influencing the observed genotype frequencies.

Table 5: HWE for SIRT1 gene

Genotype	Actual value	Expected value	p-value
AA	182	178.76	0.027
AG	29	35.48
GG	5	1.76

Table 6 presents the association between sirtuin 1 levels and the SNP (single nucleotide polymorphism) of the SIRT1 gene. It compares serum sirtuin 1 levels categorized by genotype, with a cut-off value of 2.181 ng/ml. For individuals with the AA genotype, 73 had serum sirtuin 1 levels below or equal to 2.181 ng/ml, while 25 had levels above 2.181 ng/ml. This difference was found to be statistically significant with a p-value of 0.001**.Similarly, for individuals with the AG+GG genotypes combined, 2 had serum sirtuin 1 levels below or equal to 2.181 ng/ml, while 8 had levels above 2.181 ng/ml. However, the association for this genotype group had no statistical significance. Overall, data suggests a strong association between the AA genotype of the SIRT1 gene and serum sirtuin 1 levels below or equal to 2.181 ng/ml.

Table 6: Association of sirtuin 1 levels with the SNP

Genotype

Serum sirtuin 1 level </=2.181 ng/ml

Serum sirtuin 1 level >2.181 ng/ml

p-value

0.001**

AG+GG

Table 7 illustrates the relationship between polymorphism of SIRT 1 gene among cases and stages of albuminuria. Genotypes are divided based on albuminuria stages A2 and A3. For individuals with the AA genotype, a higher proportion were observed in stage A3 compared to stage A2. However, this difference did not reach statistical significance.Conversely, for individuals with the AG+GG genotypes combined, a smaller proportion were observed in stage A3 compared to stage A2.Overall, the data indicates a trend, but not a statistically significant association, between SIRT1 gene polymorphism and stages of albuminuria.

Table 7: Polymorphism of SIRT 1 gene AND stages of albuminuria in DN

Genotype	A2	A3	p-value
AA	71	27	0.228
AG+GG	9	1	0.228

Table 8 summarizes the distribution of ACE genotypes across varied stages of estimated glomerular filtration rate (eGFR). The table indicates a notable variation in genotype distribution among different eGFR stages. In particular, statistically noteworthy significant differences were observed in the distribution of genotypes among individuals with eGFR >90 ml/min (G1 stage). The distribution patterns provide insights into potential associations between ACE genotypes and eGFR stages.

Table 8: ACE genotype frequency distribution in various stages of eGFR

Staging	Genotype AA	Genotype AG	Genotype GG	p-value
G1	6	1	00	0.0016**
G2	21	00	00
G3a	19	3	2
G3b	12	0	0
G4	16	1	0
G5	24	1	2

Table 9 shows that there is no significant difference in serum SIRT1 levels among the stages of DN, as indicated by the p-value of 0.33. Overall, the data suggests that serum SIRT1 levels remain relatively consistent across the various stages of diabetic nephropathy.

Table 9: Comparison of serum SIRT 1 level in stages of DN classified based on estimated glomerular filtration rate

Staging	SIRT 1 serum levels (Median, IQR)	p-value
G1	1.91 (1.83, 2.09)	0.33
G2	2.09 (2.06, 2.164)
G3a	2.17 (2.04, 2.53)
G3b	2.114 (2.04, 2.161)
G4	2.125 (2.064, 2.444)
G5	2.147 (2.073, 2.293)

DISCUSSION:

The study revealed a link between SIRT1 rs3740051 polymorphism and serum sirtuin 1 levels in type-2 diabetic nephropathy (DN) patients. It demonstrated a significant disparity in serum sirtuin 1 levels between DN patients and type-2 diabetic individuals. Furthermore, the distribution of Sirtuin 1 genotypes deviated from Hardy-Weinberg equilibrium, suggesting potential genetic influences on genotype frequencies in the population. However, despite these genotype frequency differences, no strong association was observed between Sirtuin 1 genotypes and various stages of albuminuria in DN patients.

These findings should be interpreted considering factors like sample size, patient demographics, comorbidities, and other genetic or environmental factors. Letonja et al.²² identified an association between SIRT1 rs7069102 gene polymorphism and DN patients, indicating a higher DN risk in CC genotype carriers compared to CG and GG genotypes. Yue et al.²³ observed significant differences in SIRT1 SNP frequencies between diabetic kidney disease patients and controls. Sun et al.²⁴ reported similar allelic frequencies for certain SIRT1 loci between diabetic nephropathy patients and those without renal issues.

Zhao et al.²⁵ examined the association between SIRT1 rs3818292, rs4746720, and rs10823108 loci, inferring a significant association between the AA genotype at the rs10823108 locus and reduced DN risk. Maeda et al.²⁰ explored SIRT1 SNPs in the Japanese population, noting associations with DN, albeit not statistically significant. Tang et al.²⁶ identified the SIRT1 rs4746720 locus as a factor of risk for diabetic kidney disease development in Chinese Han patients.

Gok et al.²⁷ and Shao et al.²⁸concluded that sirtuin 1 serum level could serve as potential biomarkers in Turkish and Chinese type-2 diabetes mellitus patients. Functionally, SIRT1 helps reduce kidney inflammation, regulates cellular senescence, promotes autophagy, and affects molecular pathways involved in fibrosis and metabolism. These renoprotective effects are mediated by SIRT1's enzymatic deacetylase activity, making it a promising target for kidney disease treatment.

CONCLUSION:

In conclusion, our cross-sectional study revealed lower serum SIRT1 levels in diabetic nephropathy (DN) patients compared to controls, implying a plausible involvement of SIRT1 in the disease's pathogenesis. Additionally, the observed deviation of SIRT1 genotypes from Hardy-Weinberg equilibrium suggests a potential genetic association with diabetic nephropathy. However, further investigations with a much bigger sample sizes and longitudinal studies are imperative to validate these findings comprehensively. Such endeavors will enhance our understanding of SIRT1's role in diabetic nephropathy pathogenesis and its potential utility as a biomarker or therapeutic target for this condition.

REFERENCES:

1. Rezkita F. Wibawa KG. Nugraha AP. Curcumin loaded Chitosan Nanoparticle for Accelerating the Post Extraction Wound Healing in Diabetes Mellitus Patient: A Review. Research J. Pharm. and Tech. 2020; 13(2): 1039-1042. doi.org/10.5958/0974-360X.2020.00191.2

2. Tandi Joni. Maila NFR. Herlambang W. Nurzafika. Viani Anggi. Handayani TW. Test effects of Ethanol Jatropha gossypifolia L extract against Diabetic Nephropathy. Research Journal of Pharmacy and Technology. 2022; 15(9): 3841-6. doi.org/10.52711/0974-360X.2022.00644

3. Munish Kakkar. Shreeja Singh. Tapan Behl. Sukhbir Singh. Neelam Sharma. Hema. Monika Sachdeva. Update on the role of Angiogenesis in Diabetes associated Nephropathy. Research Journal of Pharmacy and Technology. 2021; 14(7): 3947-4. doi.org/10.52711/0974-360X.2021.00685

4. Abbas Sabbar Dakhil. Association of the ATP-binding Cassette Transporter A1 Gene Polymorphism with Lipid Profile and Type 2 Diabetes Mellitus. Research J. Pharm. and Tech 2019; 12(10): 4657-4662. doi.org/10.5958/0974-360X.2020.00201.2

5. Astha Jaiswal. Bhupesh Chandra Semwal. Sonia Singh. A Compressive Review on Novel Molecular Target of Diabetic Nephropathy. Research Journal of Pharmacy and Technology. 2022; 15(3): 1398-4. doi.org/10.52711/0974-360X.2022.00233

6. Wolf G. Sharma K. Pathogenesis, Clinbical manifestations, and Natural History of Diabetic Nephropathy. Comprehensive Clinical Nephrology. Elsevier Saunders.2000. doi.org/10.1159/000324939

7. Tamilisetti Vidya Sagar. Yatish Byndoor. Anupam Das. Prescribing pattern of Antihypertensive, Anti-Diabetic, Hypolipidaemic and Anti-Obesity Drugs in Diabetic Nephropathy. Research Journal of Pharmacy and Technology. 2022; 15(5): 2240-3. doi.org/ 10.52711/0974-360X.2022.00372

8. Gupta S. Dominguez M. Golestaneh L. Diabetic Kidney Disease: An Update. Medical Clinics of North America. 2023; 107 (4): 689-705. doi.org/10.1016/j.mcna.2023.03.004

9. Nur Samsu. Setyawati Soeharto. Muhaimin Rifai. Achmad Rudijanto. The Superiority of Rosmarinic Acid over Vitamin E in Preventing Development and Inhibiting Progression of Diabetic Nephropathy in Rats. Asian J. Pharm. Res. 2020; 10(3): 131-139. doi/org/10.5958/2231-5691.2020.00025.8

10. Jaiswal A. Semwal BC. Singh S. A Compressive Review on Novel Molecular Target of Diabetic Nephropathy. Research Journal of Pharmacy and Technology. 2022; 15(3): 1398-4. doi.org/10.52711/0974-360X.2022.00233

11. Afkarian M. Sachs MC. Kestenbaum B. Hirsch IB. Tuttle KR. Himmelfarb J. et al. Kidney disease and increased mortality risk in Type 2 diabetes. J Am Soc Nephrol. 2013; 24(2): 302-308. doi.org/10.1681/ASN.2012070718.

12. Vadivelan R. Umasankar P. Dipanjan Mandal. Shanish A. Dhanabal SP. Elango K. Oxidative Stress Induced Diabetic Nephropathy. Research J. Pharmacology and Pharmacodynamics. 2010; 2(5): 321-323. doi.org/ 10.5958 2321-5836

13. Maysoon Mohammed Hassan. The significance of interleukin 4 (IL-4) (590-C/T) gene polymorphism in Iraqi patients with type 2 diabetes mellitus: A case-control study. Research J. Pharm. and Tech. 2019; 12(11): 5133-5137. doi.org/0.5958/0974-360X.2019.00889.8

14. Rao V. Rao V. Tan SH. Candasamy M. Bhattamisra SK. Diabetic nephropathy: An update on pathogenesis and drug development. Diabetes & Metabolic Syndrome: Clinical Research & Reviews. 2019; 13(1): 754-762. doi.org/10.1016/j.dsx.2018.11.054.

15. Kurylowicz A. In search of new therapeutic targets in obesity treatment: Sirtuins. Int. J. Mol. Sci. 2016; 17(4): 572.doi.org/ 10.3390/ijms17040572

16. Kong L. Wu H. Zhou W. Luo M. Tan Y. Miao L. Cai L. Sirtuin 1: A Target for Kidney Diseases. Mol Med. 2015; Jan 12; 21(1): 87-97. doi.org/10.2119/molmed.2014.00211

17. Kume S. Thomas MC. Koya D. Nutrient sensing, autophagy, and diabetic nephropathy. Diabetes. 2012; 61: 23–9. doi.org/10.2337/db11-0555

18. Yoshizaki T. Schenk S. Imamura T. Babendure JL. Sonoda N. Ju Bae E. et al. SIRT1 inhibits inflammatory pathways in macrophages and modulates insulin sensitivity. Am J Physiol Endocrinol Metab. 2010; 298(3): 419-28. doi.org/ 10.1152/ajpendo.00417.2009.

19. Wang W. Sun W. Cheng Y. Xu Z. Cai L. Role of sirtuin-1 in diabetic nephropathy. J Mol Med (Berl) 2019; 97(3): 291-309. doi.org/10.1007/s00109-019-01743-7.

20. Kitada M. Kume S. Takeda-Watanabe A. Kanasaki K. Koya D. Sirtuins and renal diseases: Relationship with aging and diabetic nephropathy. Clin Sci (Lond) 2013; 124 (Pt3): 153-64. doi.org/10.1042/CS20120190

21. Zhang A. Wang H. Qin X. Pang S. Yan B. Genetic analysis of SIRT1 gene promoter in sporadic Parkinson’s disease. Biochemical and Biophysical Research Communications. 2012; 422 (4): 693-696. doi.org/10.1016/j.bbrc.2012.05.059

22. Letonja J. Zavrsnik M. Makuc J. Seruga M. Peterlin A. Cilensek I. et al., Sirtuin 1 rs7069102 polymorphism is associated with diabetic nephropathy in patients with type-2 diabetes mellitus. Bosn J Basic Med Sci. 2021; 21(5): 642-646. doi.org/ 10.17305/bjbms.2020.5368

23. Yue XG. Yang ZG. Zhang Y. Qin GJ. Liu F. Correlations between SIRT1 gene polymorphisms and diabetic kidney disease. R Soc Open Sci. 2018; Jun 13; 5(6): 171871. doi.org/10.1098/rsos.171871

24. Sun Y. Wang J. Meng Y. Correlation Between Polymorphisms of the SIRT1 Gene microRNA Target Sites and Diabetic Nephropathy. Genet Test Mol Biomarkers. 2021; 25(6): 387-398. doi.org/10.1089/gtmb.2020.0261

25. Zhao Y. Wei J. Hou X. SIRT1 rs10823108 and FOXO1 rs17446614 responsible for genetic susceptibility to diabetic nephropathy. Sci Rep. 2017; 7(1): 10285. doi.org/10.1038/s41598-017-10612-7

26. Tang K. Sun M. Shen J. Zhou B. Transcriptional Coactivator p300 and Silent Information Regulator 1 (SIRT1) Gene Polymorphism Associated with Diabetic Kidney Disease in a Chinese Cohort. Exp Clin Endocrinol Diabetes. 2017; 125(8): 530-537. doi.org/10.1055/s-0043-103966.

27. Gok O. Karaali Z. Ergen A. Ekmekci SS. Abaci N. Serum sirtuin 1 protein as a potential biomarker for type 2 diabetes: Increased expression of sirtuin 1 and the correlation with microRNAs. J Res Med Sci. 2019; Jun 25; 24: 56. doi.org/ 10.4103/jrms.JRMS_921_18

28. Shao Y. Ren H. Lv C. Ma X. Wu C. Wang Q. Changes of serum Mir-217 and the correlation with the severity in type 2 diabetes patients with different stages of diabetic kidney disease. Endocrine. 2017; 55(1): 130–138. doi.org/10.1007/s12020-016-1069-4

Received on 14.08.2023 Modified on 07.11.2023

Research J. Pharm. and Tech 2024; 17(6):2829-2834.

DOI: 10.52711/0974-360X.2024.00444