INTRODUCTION:

Lithium isa mood stabiliser used as one of the first-line therapeutic modalities for Bipolar Affective Disorder (BAD)¹, a quick mood shifts between mania² to depression. Lithium has ablood therapeutic concentration of 0.5 – 0.8mEq/L³ and atoxic concentration of 1.5mEq/L in adults⁴.

Several guidelines have different perspectives concerning lithium usage in pregnant women with BAD⁵. These differing perspectives were due to the pros and contrasof using lithium during pregnancy. On the one hand, lithium discontinuation during pregnancy might increase the risk of BAD symptoms relapsing in the mother. Still, on the other hand, lithium has the potential to cause congenital malformations in the foetus⁶. Thus, further knowledge about the comprehensive consequences of lithium usage during pregnancy, both towards the mother and the developing foetus, is needed to formulate the guidelines for dose adjustments, monitoring, and necessary tapering down of lithium during pregnancy.

Lithium works by influencing the work of kinases and phosphatases⁷. One of its mechanisms of action is the inhibition of Glycogen Synthase Kinase 3β (GSK-3β)⁸. GSK-3β is an enzyme that acts as the canonical Wnt/β-xu 2016 catenin signalling pathway inhibitor⁹. Some of these Wnt target genes play essential roles in regulating organogenesis; thus, the changes in their expression by continuous activation of the Wnt/β-catenin signalling pathwayresult in organ malformations. One of the processes regulated by the Wnt/β-catenin signalling pathway is heart organogenesis.Wnt/β-catenin signalling has biphasic effects in zebrafish embryonic heart formation¹⁰. Thus, it was hypothesised that continuous activation of Wnt/β-catenin signalling caused by lithium would lead to dysregulation of cardiomyocyte formation and embryonic heart development.Another process regulated by canonical (Wnt/β-catenin) and non-canonical Wntsignallingpathways is eye organogenesis. The continuous activation of the Wnt/β-catenin pathwaywould inhibit the expression of Eye Field Transcription Factors (EFTFs) in eye organogenesis, increasing the risk of eye malformations¹¹.

The potential mechanism of lithium-induced fetalheart and eye malformation explained above is yet to be proven. This study aimed to investigate the change in the expression of Wnt target genes involved in the heart and eye organogenesis. The target genes studied that are involved in heart organogenesis were nkx2.5 (nk homeobox 2.5) and myl7 (myosin regulatory light chain 7)¹⁰. Wnt target genes studied that are involved in eye organogenesis were six3a (sine oculis homeobox 3a) and rx3 (retinal homeobox 3), both of which are EFTFs that act as transcription factors in eye field formation¹¹.

Thus, it was hypothesised that continuous lithium exposure during the embryonic period would change the expression of heart organogenesis-associated genes and EFTFs, which lead to dysregulation of the embryonicheart and eye development. This research investigated the changes in the expression of heart organogenesis-associated genes and EFTFs and the heart and eye morphological changes in zebrafish embryos exposed to lithium and zebrafish larvae previously exposed to lithium during their embryonic period.

MATERIAL AND METHODS:

Chemicals:

Lithium Chloride (LiCl) (CAS no.310468-100G, purity ≥99%) was obtained from Sigma-Aldrich, Merck Chemicals and Life Sciences, Jakarta, Indonesia. LiCl was dissolved in Hydrobattdemineralised water to prepare the stock solution of 10g/L LiCl.

Animals:

Zebrafish (Danio rerio) embryos and larvae aged 0 hours post fertilisation (hpf) – 5 days post fertilisation (dpf) used for LiCl exposure were obtained from fertilisation between male and female wild-type in a 1:1 ratio. The wild-type zebrafish characterised by dark blue-black horizontal stripes were reared in the Pharmacology Laboratory, Faculty of Medicine, Brawijaya University, Malang, Indonesia and have been tested and certified at the Hydrology Laboratory, Faculty of Fisheries and Marine Sciences, Brawijaya University, Malang, Indonesia. All experimental work was approved by the Health Research Ethics Commission of Brawijaya University with the ethical approval number 272/EC/KEPK – S2/09/2023.

Exposure:

Lithium exposure into zebrafish embryos was done by incubating the embryos (triplicates of n = 100 per group) in the LiCl (0, 3, 30, and 300mg/L)^12,13 solution prepared by diluting 10g/L or 1% LiCl aqueous stock solution (obtained from dissolving 1g of LiCl powder in 100ml of distilled water¹⁴) in embryonic medium solution(0.05g/L CaCl₂, 0.03g/L KCL, 1g/L NaCl, 0.163g/L MgSO₄, and 0,5mg/L methylene blue in Hydrobatt water). Zebrafish embryos were kept in 6 multi–wellplates, each wellcontaining 30 embryos in 10 ml of embryonic medium solution. Embryos were maintained at 27±1°C.

Zebrafish embryos were exposed to LiClfrom 1 hpf until 72 hpf, with the LiCl–embryonic medium solution changed every 24 hours. After 72 hpf, the hatched larvae were washed with theembryonic medium solution without LiCl and kept until 120 hpf, with the embryonic medium changed every 24hours.

Gene Expression Analysis:

Zebrafish embryos aged 13 hpf (triplicates of n = 60 per group, pooled) and larvae aged 72 hpf (triplicates of n = 30 per group, pooled) were isolated from the multi–well plates and submerged in DNA/RNA Shield (cat. no. R1200-125, Zymo Research, California, USA) inside 1.5 ml microcentrifuge tubes. The submerged embryos and larvae were then homogenised using a micro pestle and 3 ml syringe with 23G needles. The homogenised samples inside DNA/RNA Shield were then processed for total RNA isolation.

Total RNA was isolated and purified using the Quick-RNA Miniprep Plus Kit (cat. no. R1058, Zymo Research, California, USA) according to the manufacturer’s protocol. The quantity and purity of total RNA were examined using theBioDrop DUO+ spectrophotometer (cat. no. 80-3006-68, BioDrop, Cambridge, UK). The cDNA library was prepared from total RNA (2 µg) using the ReverTraAce^TM qPCR RT Master Mix with gDNA Remover (cat. no. FSQ-301, Toyobo, Osaka, Japan) according to the manufacturer’s protocol.

The constructed cDNA underwent quantitative real-time PCR (qPCR) amplification and analysis using Thunderbird^tm Next SYBR® qPCR Mix(cat. no. QPX-201, Toyobo, Osaka, Japan) on CFX Opus 96 Real-Time PCR System (cat. no. 12011319, BioRad, California, USA). qPCR was performed with the target genesnkx2.5, nppa, and myl7 related to heart organogenesis, and six3a andrx3related to eye organogenesis, with the housekeeping gene rpl13a (ribosomal protein l13a) for chemical analysis¹⁵. The primers used for qPCR were ordered by nucleotide sequences from Integrated DNA Technologies (Iowa, USA). The primer sequence for rpl13a was obtained from Xu et al, 2016¹⁵, the primer sequence for nppa was obtained from Becker et al., 2012¹⁶, and the primer sequences fornkx2.5, myl7,six3a and rx3 were obtained from the BioDB database platform. The primer data is shown in Table 1.

Toxicological evaluation of Heart Morphology and Contractility.

Heart morphology was assessed based on representative score assignment of the heart for zebrafish teratogenicity assay¹⁷. The scoring system assessed the heart size, atrial:ventricular size ratio, the definition of the heart, and the distinction between the heart chambers. The score used was 1-5, with a scoreof 1 representing the most dysmorphic heart and 5 representing the normal heart. The scoring system for heart morphology is explained in Table 2.

Heart contractility was assessed based on contraction strength, synchronicity between the atrium and ventricle, and contraction rhythm. The score used was 3-6, from the sum of contraction strength (1= Weak, 2 = Strong), synchronicity (1=Asynchronous, 2=Synchronous), and rhythm (1=Arrhythmic, 2=Rhythmic).

Toxicological Evaluation of Eye Morphology.

After the 72 hpf mark, zebrafish larvae(triplicates of n = 10 per group) were maintained at 27±1°C in the embryonic medium solution without LiCl, with the embryonic medium solutionchanged daily. Eye morphology was observed microscopically usinga light microscope, an Olympus CX21FS1 (Tokyo, Japan). Eye morphology was assessed based on representative score assignment of the facial region for zebrafish teratogenicity assay¹⁷ with modifications to specify the eye morphology, using the eye shape, size, and pigmentation. The score was 1-5, with a score of 1 representing the most dysmorphic eyes and a score of 5 representing the normal eyes.The scoring system for eye morphology is explained in Table 2.

Table 1. Primers used for qPCR

Gene	Primers	GC%	Tm (°C)	Amp Size (bp)
rpl13a	F:5'TGGTGAGGTGTGAGGGTATCAAC	52.2	58.5	310
rpl13a	R:5' AATTTGCGTGTGGGTTTCAGAC	45.5	56.4	310
nkx2.5	F:5' CGCGAAGAACTTCCTAGAAATG	45.5	53.7	228
nkx2.5	R:5' AAGTATTTCTGCTGCTTGAAGC	40.9	53.8	228
nppa	F:5' GATGTACAAGCGCACACGTT	50.0	59.5	110
nppa	R:5' TCTGATGCCTCTTCTGTTGC	50.0	57.9	110
myl7	F:5' CAGACAGTGAACATGGCTAGTA	45.5	54.1	99
myl7	R:5' TTGTGATTGCTCAAACATGGAG	40.9	53.8	99
rx3	F:5' GGTGGTAAATTGTCGGATGATG	45.5	53.8	191
rx3	R:5' TTTTGGAACCACACCTGTACTC	45.5	55.0	191
six3a	F:5' CCTAGGACCGGTTGATAAGTAC	50.0	54.2	124
six3a	R:5' GTACCACTCTCGTAACAGACTC	50.0	54.2	124

nkx2.5 expression was downregulatedin zebrafish embryos aged 13 hpf exposed to LiCl (A), but then upregulated in zebrafish larvae aged 72 hpf exposed to LiCl (B). nppaexpression was downregulated in zebrafish embryos aged 13 hpf and larvae aged 72 hpf exposed to LiCl (C, D). myl7 expression was downregulated in zebrafish embryos aged 13 hpf and larvae aged 72 hpf exposed to LiCl (E, F).

Among those gene expression changes, only nkx2.5 expression change was significant (B)

n = 3, centre: mean, error bars: SE, significant difference: P<0.05, *: significant difference compared to control group,**: significant difference compared to 3mg/L LiCl group

It was found that lithium exposure had a biphasic effect on the average relative mRNA levels of nkx2.5. In zebrafish embryos aged 13hpf, the average relative mRNA levels of nkx2.5 decreased in groups exposed to LiCl compared to the control group, but the differences were not statistically significant (Figure 1A). Meanwhile, in zebrafish larvae aged 72 hpf, the mRNA levels nkx2.5 differed significantly between groups, with the increase in groups previously exposed to LiCl during the embryonic period compared to the control group (Figure 1B). In the larvae aged 72hpf, the concentration of previous LiCl exposure during the embryonic period was also found to positively correlate with the average relative mRNA levels of nkx2.5, with acorrelation coefficient of 0.797(P < 0.05).

The average relative mRNA levels of nppa were found to be constantly decreased in groups exposed to LiCl compared to the control group, both in embryos aged 13 hpf, which were still exposed to LiCl (Figure 1C) and in larvae aged 72 hpf, which were no longer exposed to LiCl (Figure 1D). Similarly, the average relative mRNA levels of myl7 were found to be constantly decreased in groups exposed to LiCl compared to the control group, both in embryos aged 13 hpf, which were still exposed to LiCl (Figure 1E) and in larvae aged 72 hpf which were no longer exposed to LiCl (Figure 1F). Despite the differences in the average mRNA levels of nppaand myl7 between groups, the changes were statistically insignificant, most likely due to the large variations in the expression seen in each studied group.

LiCl Exposure during Embryonic Period Affected Heart Morphology and Contractility in Zebrafish Larvae Aged 96 hpf:

The investigation of the heart morphology and contractility of zebrafish larvae was conducted in this study. The heart morphology and contractility were observed at 96 hpf when the hearts were fully formed. However, the zebrafish larvae’s body was still transparent, allowing clear determination of the heart and distinction between the atria and ventricles. Even though LiCl was only exposed to the zebrafish during the embryonic period at 1-72 hpf, larvae aged 96 hpf that were previously exposed to LiCl showed disturbance in heart formation and contractility, indicated by the lower heart morphological score and contractility score compared to the control group.

The heart morphological score used in this study was 1-5, with the scoring criteria of 1) Hearts with very small atrium and ventricle, irregular shape, and unclear definitions, 2) Hearts with hypertrophied atrium and ventricle, irregular shape, and unclear definitions, 3) Hearts that have small atrium and ventricle with defined shape, but unclear border, 4) Hearts with smaller ventricle than normal, with atrium: ventricle ratio of 1:1, and 5) Normal hearts with atrium: ventricle ratio of 1:1.5. The heart morphological score representation in zebrafish larvae aged 96 hpf is displayed in Figure 2.

Figure 2. Heart Morphological Score Representation

Heart morphological score was assessed based on heart size, atrial and ventricular size ratio, and definition of the heart structure, atria, and ventricles. The hearts are indicated with black or white arrows, the atria are marked with red dashed lines, and the ventricles with yellow dashed lines. Score 5 (A) indicated normal hearts with an atrium:ventricle ratio of 1:1.5. Score 4 (B) indicated hearts with smaller ventricles than normal, with an atrium:ventricle ratio of 1:1. Score 3 (C) indicated hearts that have small atrium and ventricle with defined shape, but unclear borders. Score 2 (D) indicated hearts with hypertrophied atrium and ventricle, irregular shape, and unclear definitions. Hearts with the score of 1 were not observed in this study.

The heart contractility in this study was assessed based on contraction strength, synchronicity between the atrium and ventricle, and contraction rhythm. The score used was 3-6, from the sum of contraction strength (1= Weak, 2 = Strong), synchronicity (1=Asynchronous, 2=Synchronous), and rhythm (1=Arrhythmic, 2=Rhythmic).

It was found that the heart morphological score was significantly reduced in groups exposed to LiCl compared to the control group (P<0.05). The concentration of LiCl exposure during the embryonic period was also found to negatively correlate with the heart morphological score, with acorrelation coefficient of -0.896 (P<0.05). The heart contractility score was also significantly reduced in groups previously exposed to LiCl during the embryonic period compared to the control group (P<0.05). The concentration of LiCl exposure during the embryonic period was also found to negatively correlate with the heart contractility score, with acorrelation coefficient of -0.887 (P<0.05). The heart morphological and contractility score distribution in zebrafish larvae that were previously exposed to LiCl during the embryonic period is displayed in Table4.

Table 4. Distribution of Scores for Heart Morphology and Contractility.

	Heart Morphological Score
Concentration of LiCl Exposure during the Embryonic Period	1	2	3	4	5
	Percentage of Zebrafish Larvae with The Above Heart Morphological Score (%)
0 mg/L	0	0	0	0	100
3 mg/L	0	33.33*	0	33.33*	33.33*
30 mg/L	0	50*	50*	0	0*
300 mg/L	0	100*	0*	0	0*
	Heart Contractility Score
Concentration of LiCl Exposure during the Embryonic Period	3	4	5	6
	Percentage of Zebrafish Larvae with The Above Heart Contractility Score (%)
0 mg/L	0	0	0	100
3 mg/L	0	0	66.67*	33.33*
30 mg/L	25*	25*	50*	0*
300 mg/L	33.33*	33.33*	33.33*	0*

Heart morphology: 100% of zebrafish in the control group have normal heart morphology (score 5). The percentage of normal heart morphology decreased and the incidence of cardiac hypertrophy increased with the increase of LiCl exposure concentration. Starting from the LiCl concentration of 30mg/L, none of the zebrafish larvae had normal heart morphology, and 100% of zebrafish larvae in the 300mg/L LiCl group have hypertrophied hearts (score 2).

Heart contractility: 100% of zebrafish in the control group have strong, synchronous, and rhythmic heart contractility (score 6). The average contractility score decreased with the increase of LiCl exposure concentration. Starting from the LiCl concentration of 30mg/L, none of the zebrafish larvae have normal heart contractility.

Significant difference: P<0.05, *: significant difference compared to the control group.

LiCl Exposure during the Embryonic Period Affected the mRNA Levels of Eye Field Transcription Factors (EFTFs) in Zebrafish Embryos and Larvae.

This study investigated the expression of EFTF genes six3a and rx3. The EFTF expressions were measured at two-time points. The first time point was at 13 hpf when the embryos were still exposed to LiCl, and the eye organogenesis was beginning to investigate the effects of lithium exposure to EFTF expression in the early stage of eye organogenesis. The second time point was at 72hpf, when the hatched larvae were no longer exposed to LiCl, to study the effects of LiCl exposure during the embryonic period on the hatched organisms that were not exposed to LiCl anymore. The mRNA levels of EFTFs in zebrafish embryos and larvae are displayed in Figure 3.

Figure 3. Changes in EFTF expression in Zebrafish Embryos aged 13 hpf exposed to LiCl and Larvae aged 72 hpf previously exposed to LiCl during the Embryonic Period

six3a expression was downregulated in zebrafish embryos aged 13 hpf and larvae aged 72 hpf exposed to LiCl (A, B). rx3 expression was upregulatedin zebrafish embryos aged 13 hpf exposed to LiCl (C), but then downregulated in zebrafish larvae aged 72 hpf previously exposed to LiCl (D).

Among those gene expression changes, only six3a expression change was significant (B)

n = 3, centre: mean, error bars: SE, significant difference: P < 0.05, *: significant difference compared to control group.

At 13 hpf, the average relative mRNA levels of six3a decreased in zebrafish embryos exposed to LiCl compared to the control group, but the difference was not statistically significant (Figure 3A). Meanwhile, in larvae aged 72 hpf, the mRNA levels of six3a differed significantly between groups. The groups previously exposed to LiCl during the embryonic period showed decreased six3a mRNA levels compared to the control group, and mRNA levels decreased with the increase of LiCl concentration during the embryonic period (Figure 3B).

Meanwhile, lithium exposure had a biphasic effect on the average relative mRNA levels of rx3, but the differences were not statistically significant. In the embryos aged 13 hpf, average relative mRNA levels of rx3increased slightly in groups exposed to LiCl compared to the control group (Figure 3C), while in larvae aged 72 hpf, average relative mRNA levels of rx3 decreased slightly in groups previously exposed to LiCl during the embryonic period compared to the control group (Figure 3D). Despite the changes of genes expression, the levels were statistically insignificant compared to the control group. This was most likely due to the large variations in the expression seen in each group being studied.

LiCl Exposure during Embryonic Period Affected Eye Morphology in Zebrafish Larvae Aged 96 hpf

The eye morphology was observed at 96 hpf, when the eyes were fully formed but the rest of the zebrafish larvae’s body was still transparent, allowing clear determination of the eyes and structures around the eyes. Despite LiCl was only exposed to the zebrafish during the embryonic period at 1-72 hpf, larvae aged 96 hpf that were previously exposed to LiCl showed disturbance in eye formation, indicated by the lower eye morphological score compared to the control group.

The eye morphological score used in this study was 1-5, with the scoring criteria of 1) Hypoplastic and small eyes, 2) Large eyes with abnormal shape and uneven/pale pigmentation, 3) Large eyes with abnormal shape but normal pigmentation, or normal eye shape but uneven/pale pigmentation, 4) Eyes with slightly abnormal shape and unclear borders with surrounding structures, and 5) Normal eyes. The eye morphological score representation in zebrafish larvae aged 96 hpf is displayed in figure 4.

Figure 4. Eye Morphological Score Representation

Eye morphological score was assessed based on the eye shape, size, and pigmentation. Score 5 (A) indicated normal eyes which are round, proportional to the facial region, and have full black pigmentation. Score 4 (B) indicated round black eyes with blebs along the edges (white arrowheads), making the borders with surrounding structures unclear. Score 3 (C, D) indicated abnormally – shaped eyes with ridges along the edges (white stars) but still have full black pigmentation (C), or eyes with disrupted pigmentation (white arrows) but still round – shaped (D). Score 2 (E) indicated abnormally – shaped eyes with disrupted pigmentation. Eyes with the score of 1 were not observed in this study.

It was found that the eye morphological score was significantly reduced in groups previously exposed to 30 mg/L and 300mg/L LiCl during the embryonic period compared to control group and group previously exposed to 3mg/L LiCl during the embryonic period (P<0.05). Meanwhile, there were no significant differences between control group and 3mg/L LiCl group, and between 30mg/L and 300mg/L LiCl groups. The concentration of LiCl exposure during the embryonic period was also found to negatively correlate with the eye morphological score, with the correlation coefficient of -0.861 (P < 0.05).The eye morphological score distribution in zebrafish larvae aged 96 hpfthat were previously exposed to LiCl during the embryonic period is displayed in table 5.

Table 5. Eye Morphological Score Distribution

	Eye Morphological Score
Concentration of LiCl Exposure during the Embryonic Period	1	2	3	4	5
	Percentage of Zebrafish Larvae and Eye Morphological Score (%)
0 mg/L	0	0	0	0	100
3 mg/L	0	0	0	0	100
30 mg/L	0	25*	25*	50*	0*
300 mg/L	0	0	66.67*	33.33*	0*

100% of zebrafish in control group and group previously exposed to 3mg/L LiCl have normal eye morphology (score 5). However, starting from the LiCl concentration of 30mg/L, none of the zebrafish larvae have normal eye morphology, and the average eye morphology score decreased with the increase of LiCl exposure concentration.

Significant difference: P<0.05, *: significant difference compared to control group.

DISCUSSION:

This study investigates zebrafish heart and eye development (Danio rerio) following lithium exposure during embryonic and larvae periods. Zebrafish was used as the animal model in this study because of their large number of embryo production¹⁸, rapid development, transparent embryos and larvae for observation¹⁹, homology of major organ system and physiology with humans^20–22 including the heart²³ and the eyes²⁴, and a well-characterized genome that is orthologous to 70% of that of a human’s²⁵, thus allows for the investigation of the molecular mechanisms of the teratogenic effects of lithium²⁶.

The chosen doses of lithium used in this study were based on the therapeutic blood concentration of lithium in humans, which ranges from 0.5 - 0.8mEq/L³. The equivalent concentrations in LiCl were 21.2 - 33.9 mg/L²⁷. The dose range was 3mg/L for sub-therapeutic, 30mg/L for therapeutic, and 300mg/L for supra-therapeutic or toxic doses.The effect of lithium exposure on the heart and eye development of zebrafish was studied by measuring the expression level of heart organogenesis-associated genes and Eye Field Transcription Factors (EFTFs) and observing eye and heart morphological changes on zebrafish embryos exposed to LiCl and larvae previously exposed to LiCl during their embryonic period.

The survival rateof zebrafish embryos and larvae decreased following higher LiCl concentration and prolonged duration of exposure.The reduced survival rate could be attributed to the toxic and teratogenic effects of lithium, including but not limited to cardiac malformations, neurodevelopmental disruptions, and growth retardation²⁸.

In heart organogenesis, the Wnt/β-catenin signalling pathway promotes the formation of the heart from the anterior lateral plate mesoderm (ALPM) during gastrulation. Early excess activation of Wnt/β-catenin signalling, in this case via inhibition of GSK-3β by lithium, causes expansion of first heart field (FHF) progenitors within the ALPM, inhibiting the formation of second heart field (SHF)²⁹. FHF will develop into atria and ventricles, while SHF develops into sinoatrial node, atrioventricular canal, inflow and outflow tracts, and pericardium³⁰. Wnt/β-catenin signalling was hypothesised to affect heart organogenesis via its target genes, three of which, nkx2.5, nppa, and myl7, were investigated in this study.

Nkx2.5 is a transcription factor that acts as one of the general regulators of heart organogenesis. In the early phase of heart formation, Nkx2.5 regulates the differentiation of cardiac progenitors from ALPM and further influences ALPM partitioning and patterning to form the heart chamber identity³⁰. Nkx2.5 also governs the formation of SHF, which forms the sinoatrial node, atrioventricular canal, inflow and outflow tracts, and pericardium³¹. Previous studies found that Wnt/β-catenin signalling has biphasic effects on the expression of Nkx2.5, with the activation of Wnt/β-catenin signalling during the pregastrula phase (3-5 hpf in zebrafish) promoting the expression of Nkx2.5, and the activation of Wnt/β-catenin signalling during the gastrulation phase (6-9 hpf in zebrafish) inhibits the expression of Nkx2.5¹⁰. Findings in this study matched those effects, in which in zebrafish embryos aged 13 hpf, just after the gastrulation phase, relative mRNA levels nkx2.5 were downregulated in groups exposed to LiCl compared to the control group, even though it was insignificant. Meanwhile, in zebrafish larvae aged 72 hpf, relative mRNA levels nkx2.5 were upregulated significantly in groups previously exposed to LiCl during the embryonic period compared to the control group. This suggested a response mechanismto compensate for insufficient formation of heart canals and pacemaker cells from SHF in the arlier stages of development.

Nppa is one of the targets of transcription factor Nkx2.5. During heart development, Nppa acts as a hormone that regulates the formation of the atrioventricular canal, proliferation of cardiomyocytes, and formation of the heart’s extracellular matrix. Besides Nkx2.5, Nppa expression is regulated by Gata4, Tbx3, and Tbx5³². The expression of Nppa is influenced by Nkx2.5 to some degree; in this study, the influence of Nkx2.5 towards the expression of Nppa was observed in zebrafish embryos aged 13 hpf, where the relative mRNA levels of nkx2.5 and nppa were downregulated in groups exposed to LiCl.

Myl7 is a regulatory protein of myosin light chain incorporated in adult organisms' atrial myofibrils which plays a role in developing the FHF, forming the myocardium of atria and ventricles³⁰. Similar to Nkx2.5, Wnt/β-catenin signalling also has biphasic effects on the expression of Myl7¹⁰. Findings in this study matched those effects, in which in zebrafish embryos aged 13 hpf and larvae aged 72 hpf, relative mRNA levels of Myl7 were downregulated in groups exposed to LiCl compared to the control group. This continuous downregulation of Myl7suggested that Myl7 has no response mechanism, hypothesised due to the already expanded FHF by early excess activation of Wnt/β-catenin signalling caused by lithium exposure.

The heart morphology and contractility differed significantly between groups, despite nkx2.5 being the only genes among the three-heart organogenesis–associated genes studied to be expressed significantly differently between groups. This study observed that the higher the LiCl concentration, the higher the incidence of cardiac hypertrophy, and the heart contractions became more erratic. These findings were consistent with the previous studies, in which lithium exposure caused early excess activation of Wnt/β-catenin signalling, which then promotes the expansion of FHF progenitors and inhibition of the SHF formation²⁹. This disequilibrium caused cardiac hypertrophy due to the expansion of atrial and ventricular myocardium areas that develop from FHF. However, it disrupted the heart contraction because of the inadequacy of pacemaker cells that develop from SHF²⁹.

In eye organogenesis, canonical Wnt/β-catenin signalling is inhibitory, while non-canonical Wnt signalling by Wnt 4 and Wnt11 promotes eye formation instead³³. The two signalling pathways regulate the expression of EFTFs, steering the development of anterior neural plate cells into the brain or eyes. The EFTFs analysed in this study were six3a and rx3, which areWnt target genes that mark eye organogenesis from anterior neural plate cells.Activation of Wnt/ꞵ-catenin signalling results in the down-regulation of six3a and rx3 expression, while Wnt11 signalling is antagonistic to Wnt/ꞵ-catenin signalling and upregulates the expression of six3a and rx3¹¹. Gene expression analysis revealed that mRNA levels of six3a were downregulated on both zebrafish embryos aged 13 hpf exposed to lithium and larvae aged 72 hpf previously exposed to lithium compared to the control group.

The eye morphology differed significantly between groups, despite Six3a being the only EFTFs among the two to show a difference in the expression between the studied groups. The eyes were substantially more deformed in the groups of zebrafish larvae previously exposed to 30mg/L and 300mg/L LiCl during the embryonic period, compared to the control and 3mg/L LiCl group. Eyes with abnormal pigmentation tended to lose pigmentation at the middle of the eye, consistent with coloboma, the failure in iris formation. One of the previous studies supported this result, which found that the loss of function of six3 genes (six3a and six3b) causes coloboma and optic nerve malformation³⁴.

Thus, it could be concluded that lithium exposure towards zebrafish during the embryonic periodcaused heartmalformations and malfunctions and eye malformations in zebrafish larvae, with the molecular mechanisms of the malformations observed in this study attributed to the changes in transcription factor expressions. The heart malformations and malfunctions were connected to the dysregulation of Nkx2.5 expression, while the eye malformations were attributed to the downregulation of Six3aexpression at the transcriptional levels. For theWnt target genes in this study that showed insignificant expression changes on transcriptional levels, the expression changes on protein levels might be caused by post-transcriptional modification and translational regulations, such as by the involvement of miRNA³⁵. There is also the probability of other Wnt target genes which are affected and play a role in heart and eye organogenesis. Further studies in heart organogenesis-associated genes and EFTF expression on protein levels, or transcriptomics and proteomics assays, are needed to confirm the molecular mechanism of lithium-induced eye malformations.

The general conclusion of this study was that lithium exposure towards zebrafish during the embryonic period caused heart malformations, heart malfunctions, and eye malformations in zebrafish larvaevia the changes in transcription factor expression on the transcriptional level. These effects persisted even after the embryos were hatched and removed from lithium exposure.

Heart and eye malformations in zebrafish larvae were observed in the larvae that hatched from the embryos that were exposed to 30mg/L and 300mg/L LiCl, with 30mg/L being the upper-middle equivalent of lithium blood therapeutic concentration in humans. Thus, when lithium is used as a therapeutic agent for BAD in pregnant women, it is essential to monitor the blood lithium concentration so that it is high enough to control the symptoms of BAD in the mother but low enough to avoid the risk of congenital malformations in the foetus.

LIST OF SYMBOLS AND ABBREVIATIONS:

ALPM= Anterior lateral plate mesoderm, BAD= Bipolar Affective Disorder, CaCl₂= Calcium chloride, dpf= Day post fertilisation, EFTF= Eye field transcription factor, FHF= First heart field, GSK-3β= Glycogen Synthase Kinase 3β, hpf= Hour post fertilisation, KCL= Potassium chloride, LiCl= Lithium chloride, MgSO_{4 =}Magnesium sulphate, NaCl= Sodium chloride, myl7= Myosin regulatory light chain 7, nkx2.5= Nk homeobox 2.5, nppa= Natriuretic peptide a, SHF = Second heart field, six3a= Sine oculis homeobox 3a, rx3= Retinal homeobox 3

ACKNOWLEDGEMENTS:

This study was financially supported by Faculty of Medicine, Brawijaya University, through the non-tax state revenue fund in accordance with the budget implementation list for fiscal year 2023 with the number DPA-FK-271101/2023-0.

The authors thank Annisatul Hakimah, SuciMegasari, and the staffs of Pharmacology Laboratory and Biomedical Central Laboratory of Faculty of Medicine, Brawijaya University for their wonderful assistance in conducting the experiments.

CONFLICTS of INTEREST:

The authors declare that there were no conflicts of interests present.

REFERENCES:

1. Shalikram Chapekar N, Student R, Chapekar NS, et al. Bipolar Disorder and Role of Lithium in Its Management: An Overview. 2010.

2. Shanthakumar J, Tamilselvan T, Arunagiri P, et al. Role of Caffeine Intake in Lithium Treated Methylphenidate Induced Oxidative Stress in an Animal Model of Mania. 2013.

3. Medić B, Stojanović M, Stimec B V., et al. Lithium - Pharmacological and Toxicological Aspects: The Current State of the Art. Curr Med Chem 2018; 27(3): 337–351. doi: 10.2174/0929867325666180904124733.

4. Ott M, Stegmayr B, Salander Renberg E, et al. Lithium intoxication: Incidence, clinical course and renal function – a population-based retrospective cohort study. Journal of Psychopharmacology 2016; 30(10): 1008–1019; doi: 10.1177/0269881116652577.

5. Larsen ER, Damkier P, Pedersen LH, et al. Use of psychotropic drugs during pregnancy and breast‐feeding. Acta Psychiatr Scand 2015; 132(S445): 1–28; doi: 10.1111/acps.12479.

6. Poels EMP, Bijma HH, Galbally M, et al. Lithium during Pregnancy and after Delivery: A Review. Int J Bipolar Disord 2018; 6(1); doi: 10.1186/s40345-018-0135-7.

7. Nasir AS, Jaffat HS. Symbiotic effect of sodium selenite and vitamin e against lithium carbonate induced brain toxicity in male rats. Res J Pharm Technol. 2017; 10(6): 1661–1665; doi: 10.5958/0974-360X.2017.00293.1.

8. Siebel AM, Vianna MR, Bonan CD. Pharmacological and Toxicological Effects of Lithium in Zebrafish. ACS Chem Neurosci. 2014; 5(6): 468–476; doi: 10.1021/cn500046h.

9. Wu D, Pan W. GSK3: A Multifaceted Kinase in WntSignaling. Trends Biochem Sci 2010; 35(3): 161–168. doi: 10.1016/j.tibs.2009.10.002.

10. Ueno S, Weidinger G, Osugi T, et al. Biphasic Role for Wnt/-Catenin Signaling in Cardiac Specification in Zebrafish and Embryonic Stem Cells. 2007.

11. Cavodeassi F, Carreira-Barbosa F, Young RM, et al. Early stages of zebrafish eye formation require the coordinated activity of Wnt11, Fz5, and the Wnt/β-catenin pathway. Neuron. 2005; 47(1): 43–56; doi: 10.1016/j.neuron.2005.05.026.

12. Nery LR, Eltz NS, Martins L, et al. Sustained behavioral effects of lithium exposure during early development in zebrafish: Involvement of the Wnt-β-catenin signaling pathway. Prog Neuropsychopharmacol Biol Psychiatry. 2014; 55: 101–108; doi: 10.1016/j.pnpbp.2014.04.011.

13. Rani Bera S, Pattanayak S, Kanta Kanthal L, et al. Locomotor activity on zebra fish model using methanolic extract of Erigeron bonariensis L. Research Journal of Pharmacology and Pharmacodynamics. 2023; 45–48. doi: 10.52711/2321-5836.2023.00009.

14. Mohandas R, Ramani P, Sherlin HJ, et al. Lithium carbonate as a bluing agent – a comparative study. Res J Pharm Technol. 2019; 12(10): 4895–4898; doi: 10.5958/0974-360X.2019.00847.3.

15. Xu H, Li C, Zeng Q, et al. Genome‐wide identification of suitable zebrafish Danio rerio reference genes for normalization of gene expression data by RT‐qPCR. J Fish Biol. 2016; 88(6): 2095–2110. doi: 10.1111/jfb.12915.

16. Becker JR, Robinson TY, Sachidanandan C, et al. In vivo natriuretic peptide reporter assay identifies chemical modifiers of hypertrophic cardiomyopathy signalling. Cardiovasc Res. 2012; 93(3): 463–470. doi: 10.1093/cvr/cvr350.

17. Panzica‐Kelly JM, Zhang CX, Danberry TL, et al. Morphological score assignment guidelines for the dechorionated zebrafish teratogenicity assay. Birth Defects Res B Dev Reprod Toxicol. 2010; 89(5): 382–395. doi: 10.1002/bdrb.20260.

18. Sabarinath C, Nandhu T, Sudhakar P, et al. Teratogenic effect of ethanolic extract of solanum xanthocarpum berries in zebrafish embryo. Res J Pharm Technol. 2020; 13(11): 5313–5316. doi: 10.5958/0974-360X.2020.00929.4.

19. Eisen JS. History of Zebrafish Research. In: The Zebrafish in Biomedical Research Elsevier. 2020; 3–14. doi: 10.1016/B978-0-12-812431-4.00001-4.

20. Sudha N, Vanisree AJ. Neuroprotective role of curcuma amada in f1 progeny of juvenile danio rerio (Zebrafish) from nickel chloride induced maternal stress in gestationally challenged adult fishes. Res J Pharm Technol. 2021; 14(8): 4215–4220; doi: 10.52711/0974-360X.2021.00731.

21. Teame T, Zhang Z, Ran C, et al. The use of zebrafish (Danio rerio) as biomedical models. Animal Frontiers. 2019; 9(3): 68–77. doi: 10.1093/af/vfz020.

22. Wilson SA, Nagaraj A, Vaidyanathan L. Calocybe indicia extract modifies gaba and serotonin levels to alleviate anxiety in experimental adult zebrafish models. Res J Pharm Technol. 2021; 14(9): 4789–4794. doi: 10.52711/0974-360X.2021.00833.

23. Gauvrit S, Bossaer J, Lee J, et al. Modeling Human Cardiac Arrhythmias: Insights from Zebrafish. J Cardiovasc Dev Dis. 2022; 9(1). doi: 10.3390/jcdd9010013.

24. Nanda A, Aparna S, Sahoo RN, et al. Effect of Amlodipine in Proliferative Retinopathy: Biochemical Estimation and Zebrafish (Danio rerio) Modeling. Res J Pharm Technol. 2022; 1114–1118. doi: 10.52711/0974-360X.2022.00186.

25. Howe K, Clark MD, Torroja CF, et al. The zebrafish reference genome sequence and its relationship to the human genome. Nature. 2013; 496(7446): 498–503. doi: 10.1038/nature12111.

26. Kuppuswamy JM, Seetharaman B. Mancozeb exposure at sublethal concentration alters the transcription of the genes related to apoptosis in the adult zebrafish (Danio rerio) brain. Res J Pharm Technol. 2020; 13(10): 4801–4804. doi: 10.5958/0974-360X.2020.00844.6.

27. Klug S, Collins M, Nagao T, et al. Effect of lithium on rat embryos in culture: Growth, development, compartmental distribution and lack of a protective effect of inositol. Arch Toxicol. 1992; 66(10): 719–728. doi: 10.1007/BF01972623.

28. Tominaga N, Shino S, Uchida M, et al. Effects of Lithium on Developmental Toxicity, Teratogenicity and Transcriptome in Medaka Embryos.

29. Mandal A, Holowiecki A, Song YC, et al. Wntsignaling balances specification of the cardiac and pharyngeal muscle fields. Mech Dev. 2017; 143: 32–41; doi: 10.1016/j.mod.2017.01.003.

30. Kemmler CL, Riemslagh FW, Moran HR, et al. From Stripes to a Beating Heart: Early Cardiac Development in Zebrafish. J Cardiovasc Dev Dis. 2021; 8(2): 1–21. doi: 10.3390/JCDD8020017.

31. Guner-Ataman B, Paffett-Lugassy N, Adams MS, et al. Zebrafish second heart field development relies on progenitor specification in anterior lateral plate mesoderm and nkx2.5 function. Development. 2013; 140(6): 1353–1363. doi: 10.1242/dev.088351.

32. Sergeeva IA, Christoffels VM. Regulation of Expression of Atrial and Brain Natriuretic Peptide, Biomarkers for Heart Development and Disease. Biochim Biophys Acta Mol Basis Dis. 2013; 1832(12). doi: 10.1016/j.bbadis.2013.07.003.

33. Fuhrmann S. WntSignaling in Eye Organogenesis. Organogenesis. 2008; 4(2): 60–67. doi: 10.4161/org.4.2.5850.

34. Samuel A, Rubinstein AM, Azar TT, et al. Six3 regulates optic nerve development via multiple mechanisms. Sci Rep. 2016; 6. doi: 10.1038/srep20267.

35. Tippabathani J, Nellore J, Suresh X. Computational identification of microRNAs binding to the transcription factors related to dopamine neurons. Res J Pharm Technol. 2018; 11(12): 5520–5528. doi: 10.5958/0974-360X.2018.01005.3.

Received on 23.01.2024 Revised on 17.04.2024

Accepted on 06.06.2024 Published on 24.12.2024

Available online from December 27, 2024

Research J. Pharmacy and Technology. 2024;17(12):5750-5760.

DOI: 10.52711/0974-360X.2024.00875

Heart Morphology Scoring Criteria
Score	Heart Size	Atrial:Ventricular Size Ratio		Structural Definition of The Heart		Distinction between Atriumand Ventricle
5	Normal	0.6 – 0.7		Clear		Clear
4	Normal	1		Clear		Clear
3	Smaller than normal	1		Clear		Unclear
2	Hypertrophied	Not applicable		Clear		Unclear
1	Hypoplastic	Not applicable		Unclear		Unclear

Eye Morphology Scoring Criteria
Score	Eye Shape		Eye:Head Size Ratio		Eye Pigmentation
5	Round		0.6 – 0.7		Fully black
4	Round with blebs on the edges		0.5 – 0.6		Fully black
3	Ridges around the edges		0.45 – 0.5 OR >0.7		Fully black
	OR
	Round with blebs on the edges		0.45 – 0.5 OR >0.7		Pale and disrupted in the middle
2	Deep ridges around the edges, dysmorphic		0.4 – 0.45		Pale and disrupted in the middle
1	Oval, dysmorphic		<0.4		Very pale in the whole eye

	Embryos (Still Exposed to LiCl)				Larvae (Previously exposed to LiCl during embryonic period)
LiCl Concentration	Survival Rate (%)
LiCl Concentration	0 hpf	13 hpf	24 hpf	48 hpf	72 hpf	96 hpf	120 hpf
0 mg/L	100	81.67	71.67	70.74	69.81	58.06	27.5
3 mg/L	100	78.89	56.48	56.29	46.29*	34.72*	15.28*
30 mg/L	100	80.56	53.15	53.15	53.15*	25.83*	7.5*
300 mg/L	100	87.22	59.26	57.78	33.33*	12.5*	0.83*