Effect of aqueous extract of Trigonellafoenum-graecum L. seeds on Acetic acid- induced Ulcerative colitis in rats
Aqsa Fathima1, Shivaprakash Gangachannaiah1*, Ujjal Bose2, Shama Prasada Kabekkodu3,
Rituparna Chakraborty4, Praveen Kumar S E5, Padmanabha Udupa6,
Rachagolla Sai Prathap Yadav7, Vidya Monappa8
1Department of Pharmacology, Kasturba Medical College, Manipal,
Manipal Academy of Higher Education, Manipal, Karnataka, India-576104.
2Department of Pharmacology, American University of Antigua College of Medicine,
Coolidge, Antigua P.O. Box 1451.
3Department of Cell and Molecular biology, Manipal School of Life Sciences,
Manipal, Manipal Academy of Higher Education, Manipal, Karnataka, India – 576104.
4Department of Microbiology, Melaka Manipal Medical College, Manipal,
Manipal Academy of Higher Education, Manipal, Karnataka, India – 576104.
5Department of Pharmacology, Manipal-Tata Medical College Jamshedpur,
Manipal Academy of Higher Education, Jharkhand, India – 831017.
6Department of Biochemistry, Kasturba Medical College, Manipal,
Manipal Academy of Higher Education, Manipal, Karnataka, India – 576104.
7Centre for Molecular Neuroscience, Kasturba Medical College,
Manipal, Manipal Academy of Higher Education, Manipal, Karnataka, India – 576104.
8Department of Pathology, Kasturba Medical College, Manipal,
Manipal Academy of Higher Education, Manipal, Karnataka, India – 576104.
*Corresponding Author E-mail: shiva.g@manipal.edu
ABSTRACT:
Background: Ulcerative colitis (UC) is an inflammatory bowel disorder affecting the colonic mucosa, characterized by intense inflammation and mucosal damage. The present study aimed to evaluate the protective effect of the Trigonellafoenum-graecum L. (TFG) seeds in acetic acid-induced UC in rats. Materials and Methods: Male rats (n=30) were distributed into 5 groups as normal control, UC, standard, and two test groups. Colitis was induced by acetic acid in all the groups except the normal control group. Normal control and UC group received distilled water, the standard group was administered sulfasalazine at 100mg/kg body weight (bw), and test groups, TFG-I, and TFG-II received TFG seed extract at 500 and 1000 mg/kg bw, respectively. The duration of treatment was 7 days, and colitis was induced on day 8. Animals were sacrificed on day 9 and colonic tissue was dissected and collected for biochemical, molecular, and histological analysis. Results: The disease activity index score in standard, TFG-I, and TFG-II (3.33±0.21, 2.66±0.21, and 3.50±0.22) was significantly lesser (P<0.05) than scores in the UC group (4±0.01). The macroscopic score indicating the intensity of mucosal inflammation was significantly decreased (P≤ 0.01) to4.0±0.25, 3.16±0.30, and 3.83±0.40 in standard, TFG-I, and TFG-II groups, respectively compared to the UC group (4.66±0.21). Similarly, there was a significant reduction (P≤0.05) in histological scores of the standard, TFG-I, TFG-II (3.5±0.34, 1.25±0.34, 3.25±0.34) groups compared to the UC group (4.75±0.34). Biochemical assessment in the standard and test groups showed significant increase (P<0.05) in total protein, reduced glutathione (GSH), catalase (CAT), superoxide dismutase (SOD) levels whereas significant reduction (P<0.01) in malondialdehyde (MDA) levels compared to UC group. The pro-inflammatory cytokine TNF-α levels were significantly decreased (P<0.01) in standard, TFG-I, and TFG-II (-1.75±0.007, -0.27±0.17 and -0.51±0.002) when compared to the UC group (0.20±0.02). Conclusion: The study demonstrates the ability of TFG seeds in reducing the inflammatory and oxidative stress induced mucosal damage in acetic acid-induced UC in rats.
KEYWORDS: Inflammatory bowel disorder, Ulcerative colitis, Trigonellafoenum-graecum L, Acetic acid, TNF-α.
INTRODUCTION:
Inflammatory bowel disease (IBD) is a chronic inflammatory disease of the gastrointestinal tract.The two main subtypes of IBD [Crohn’s disease (CD) and Ulcerative colitis (UC)] have a combined global prevalence rate of 84.3 per 100 000 population.The disease causesa significant social and economic burden to the health systems globally1,2.
Previous reports have indicated multiple factors (immunological, infectious, genetic, and environmental) responsible for the pathogenesis of UC3. These factors are implicated in causing alteration of the mucosal barrier, thereby exposingthe submucosal layers to toxins and pathogens. This leads to the development of inflammation by releasing an enormous quantity of pro-inflammatory cytokines byinfiltrated neutrophils, macrophages, and T cells. Neutrophils are involved in both acute and chronic inflammation and are responsible for the release of reactive oxygen species, chemokines, and cytokines like TNF α, IL-8, IL-1β. They accumulate in large numbers in inflamed mucosa, damage crypts, form crypt abscesses, and aggravate mucosal inflammation4-6. The activated macrophages release IL-1β, IL-6, IL-12, TNFα, and T cells of Th 2 type are responsible for the increased levels of cytokines like IL-4, 5, 13. Emerging evidence also shows activation of Th9 cells as responsible for the rise in pro-inflammatory IL-97.
Trigonellafoenum-graecum L. seeds(TFG)are rich source of protein, minerals, vitamins, gum, fiber, alkaloid, flavonoids, saponin and volatile compounds8. It is known for its medicinal properties such as antidiabetic8, anticarcinogenic, hypocholesterolemic, antioxidant, and immunological activities9-12.
Currently, UC is treated by drugs such as 5-aminosalicylic acid, corticosteroids, azathioprine, methotrexate, and infliximab. These drugs are not specific and are associated with intolerable adverse effects. Hence, it is essential to develop more specific drugs to treat this disease with a long and complex pathogenic history.Treatment with natural products is proposed as a safer and economical alternative to conventional drugs.
MATERIALS AND METHODS:
Drugs and chemicals:
Sulfasalazine (SAZO, 500mg) was procured from Wallace Pharmaceuticals Private, Limited, India. TFG seedswere obtained from the local market in Udupi, Karnataka, India, followed by due authentication by a botanist.All thereagents used were of analytical grade andwere prepared freshly before use.
Animals and ethics approval:
The study was approved bytheInstitutional Animal Ethics Committee (IAEC/KMC/93/2018), MAHE, Manipal, India. Wistar rats were procured from the Central Animal Facility of the institute following the guidelines of the Committee for the Purpose of Control and Supervision of Experimentation on Animal (CPCSEA). The study used thirty male albino Wistar rats with weights ranging between 150-250gms and aged 8-10 weeks. The animals were housed under standard conditions that included a 12:12 light-dark cycle, 50% humidity, and 28°C temperature and provided with standard food granules and water ad libitum.
Preparation of extract:
Aqueous extract of TFG was prepared as described by Noor (2007)13. Ten grams of dried and grounded fenugreek seeds were boiledin 250ml of double-distilled water for 1 h. The solution is left overnight cooled at room temperature, filtered, and made up to 250 mlusing double-distilled water.
Experimental design:
Thirty adult male rats were randomly allocated into five groups:
Group I- Normal control
Group II- UC: Acetic acid plus distilled water
Group III- Standard: Sulfasalazine (100 mg/kg) plus acetic acid14
Group IV- TFG- I (500mg/kg): Trigonellafoenum greacum L. seed extract 500mg/kg plus acetic acid
Group V- TFG- II (1000mg/kg): Trigonellafoenum greacum L. seed extract 1000mg/kg plus acetic acid
The dose of Trigonellafoenum greacum L. seed extract was selected based on the previous anti- inflammatory and toxicity study. In the acute toxicity study, there were no signs of toxicity or mortality upto 5000mg/kg of Trigonellafoenum greacum L. seeds15. Two doses of TFG seed extract were chosenbecause of its optimal anti-inflammatory activity reported in the previous reports16, 17.
Fig. 1: Schematic representation of the experimental design
Induction of Ulcerative colitis (UC):
The drugs were administered orally for 7 days, along with diet. The volume of drugs was kept constant at 5 ml/kg body weight. The control group received distilled water. On day 8 following overnight fasting, UC was induced as described by Mousavizadeh et al. (2009)18. Colitis was induced by administration of 1ml of 4% acetic acid (AA) transrectally using an 8Fr (2.7mm) soft pediatric catheter coated with lignocaine anaesthetic. The catheter was passed till 6-8cm from the anus under low dose ether anaesthesia. The rats were maintained in head-down position (Trendelenburg position) after AA administration for 10 seconds to prevent any leakage. The acidic solution was aspirated out followed by transrectal colon washing with 2 ml of phosphate buffer saline (PBS) at pH 7.018. UC was induced in groups II to V, while the normal control group received normal saline transrectally. Twenty-four hours following induction of colitis, animals were sacrificed under anaesthesia.
Colon weight/ length ratio:
Colon weight was measured in grams and length in centimeters (cms). The weight in grams to length in cmsratio was calculated as described byAleisa et al. (2014)19.
Disease Activity Index (DAI):
DAI was assessed by the method as illustrated byCooper et al. (1993)20. The changes in growth rate, stool consistency, and presence of gross bleeding or occult blood in feces were scored from 0-4 for each animal with score 0 as normal stool consistency and no occult/gross rectal bleeding whereas score 4 as diarrhoea, gross bleeding alongwitha significant decrease in growth.
Macroscopic Scoring:
Colon from each animal was scored macroscopically as published by Morris et al. (1989)21. A colon of length 4 cm extending proximally 2cm above the rectum was dissected and split longitudinally on a piece of paper, and the colon was scored macroscopically with a score of 0 as normal gross morphology and 5 as intense inflammation and ulceration.
Histopathology:
Biochemical Assessment: Preparation of Homogenate:
For the determination of tissue Total protein (TP), antioxidants, and Lipid peroxidation (LP), 10% homogenate of 10g colonic tissue was prepared with ice-cold KCL (150mM) using a homogenizer (Model: Yamato L.S.GL.H-21, Japan) and centrifuged at 3000rpm for 10 min at 4°C.
Total protein:
The total protein (TP) estimation was based on Cu2+ to Cu+ reduction by protein in an alkaline medium.Estimation was done by ELISA microplate reader23.
Reduced Glutathione:
Tissue glutathione (GSH) was estimated as described by Rahman et al. (2007). The quantity was measured by spectrophotometer (TBS, India)24.
Catalase:
Tissue catalase (CAT)was estimated as described by Aebi. (1984)25. To 50ml of 50mM PBS, 75μl of 30% of hydrogen peroxide was added. Tissue homogenate (20μl) was added to 800μl of the PBS-H2O2 solution. In this assay, the decrease in the amount of hydrogen peroxide is measured at 240nm.
Superoxide dismutase:
Superoxide radicals are formed during oxidative stressby superoxide dismutase (SOD). The substrate adrenaline bitartrate in the presence of superoxide radicals undergoes oxidation to form adrenochrome. Superoxide dismutase removes superoxide radicals causing potent inhibition of oxidation of adrenaline at pH 10-1126.
Lipid peroxidase by MDA assay:
Polyunsaturated fatty acid breaks down to form malondialdehydeisa suitable tool to determine the extent of peroxidation reaction. The pink colour formed by the reaction between thiobarbituric acid and malondialdehyde is measured at 532nm27.
Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR):
Total RNA was extracted from colonic tissues using TRI-reagent (Merck, India) as per the manufacturer’s protocol.
Primers:
TNF α
Forward 5’ CACCATGAGCACGGAAAGCA 3’
Reverse 5’ GCAATGACTCCAAAGTAGACC 3’
GAPDH:
Forward 5’ CAACTCCCTCAAGATTGTCAGCAA 3’
Reverse 5’ GGCATGGACTGTGGTCATGA 3’
Method of RT-PCR:
The total RNA with high quality and integrity ((6135000009, Eppendorf, India) and agarose gel electrophoresis (AGE)) was extracted from rat tissue biopsies using manufacturer’s protocol for TRI-Reagent (T9424, Merck, India). cDNA was synthesized (High-Capacity Reverse Transcriptase cDNA synthesis kit (Thermo Fisher Scientific India Pvt. Ltd., India)) from 180 ng/μl total RNAusing a thermocycler (T100, BioRad, India). The products from PCR amplification (GoTaq Green WS, USA) of cDNA using gene specific primers were visualised through AGE (EZ Imager, BioRad, India) using manufacturer’s protocol.
Statistical analysis:
Graph Pad Prism 5.03 Demo Version was used for all the statistical analysis (Graph Pad Software Inc., La Jolla, CA, USA) by one-way analysis of variance (Tukey test). Results expressed as Mean±SEM, and p≤0.05 was considered significant. The relative mRNA expression of TNFα was analyzed by Image-J 1.51f software (Wayne Rasband, National Institutes of Health, USA)28 using ANOVA (Dunnett’s test).
RESULTS:
The colonic weight/length ratio increased significantly (P<0.01) in the UC group (0.2100±0.008) when compared to the control group. However, there was a significant decrease (P<0.01) in colonic weight/length ratio values in the standard, TFG-I, and TFG-II (0.1167±0.004, 0.1317±0.006, 0.1150±0.005) compared to the UC group. There was no significant difference noted in the standard and the test groups when compared to the control. (Fig.2)
Table 1. Effect of TFG on DAI, macroscopic and microscopic changes in rats
|
Groups |
Disease ActivityIndex (DAI) |
Macroscopic score |
Microscopic score |
|
Normal control |
0±0 |
0±0 |
0±0 |
|
UC |
4.00±0.00 |
4.66±0.21 |
4.75±0.34 |
|
Standard (Sulfasalazine 100mg/kg) |
3.33±0.21b |
4.00±0.25b |
3.50±0.34b |
|
TFG I (500mg/kg) |
2.66±0.21b |
3.16±0.30b |
1.25±0.34b |
|
TFG II (1000mg/kg) |
3.50±0.22b |
3.83±0.40b |
3.25±0.34b |
Data is expressed as Mean± SEM (n=6). Significant difference:bP < 0.01 compared to UC.
Fig. 2. Effect of Trigonellafoenum-graecum L. seeds (TFG) on colon weight/length of rats in Normal control, UC, and rats treated with 100mg/kg of sulfasalazine, and aqueous extract of TFG at 500mg/kg and 1000mg/kg.
Significant difference: **P < 0.01 compared to Control; bP < 0.01 compared to UC.
The total DAI score was normal (0) in the control group and increased to 4 in the UC group. However, the score significantly (P<0.01) reduced in standard, TFG-I, and TFG-II (3.33±0.21, 2.66±0.21, 3.50±0.22) groups, respectively. The macroscopic score was increased to 4.66±0.21 in the UC group and significantly (P<0.01) decreased in standard, TFG-I, and TFG-II (4.00±0.25, 3.16±0.30, 3.83±0.40) respectively. The microscopic score was increased to 4.75±0.34 in the UC group and decreased significantly (P<0.01) in standard, TFG-I, and TFG-II (3.50±0.34, 1.25±0.34, 3.25±0.34) groups, respectively. (Table 1)
Histopathological changes:
In the normal control group, the colonic sections had normal architecture with no signs of ulceration and inflammation (Fig.3 A). In the UC group, there was extensive ulceration and inflammation with a maximum microscopic damage score of 4.8, indicating focal necrosis of mucosal and submucosal region with involvement of serosa. Diffuse leukocyte infiltration and crypt damage were also seen (Fig.3 B). In the groups treated with sulfasalazine, TFG- I (500mg/kg)and TFG- II (1000mg/kg), the degree of inflammation was lesser compared to the UC group, and there were no signs of crypt damage or ulceration. (Fig.3C, 3D, 3E).
Fig. 3.Effect of Trigonellafoenum-graecum L. seeds (TFG)on histological features in rats.
a: Control, b: UC- group, c: Standard(sulfasalazine 100mg/kg), d: TFG- I (500mg/kg), e: TFG- II (1000mg/kg)
BLACK ARROW: Ulceration; YELLOW ARROW: Transmural inflammation; BLUE ARROW: Crypt damage
Biochemical analysis and cytokine levels:
The levels of total proteins (TP)reduced in UC group compared to control group. TP level increased significantly (P<0.05) in standard, TFG-I, and TFG-II (259.8±9.83, 176.0±12.61, and 244.5±10.90), respectively compared to UC. However, the levels of TP werelower (P<0.05) in TFG-I, TFG-II compared to the normal control (Fig.4a). The levels of CAT decreased in the UC group and increasedin standard, TFG-I, and TFG-II (6.23±0.20, 4.05±0.38, and 5.83±0.43) compared to UC. However, the restoration was not complete in TFG-I group, as the levels were lower (P<0.01) when compared to normal control (Fig.4b). The levels of SOD decreased in the UC group. Levels of SOD weresignificantly (P<0.01) restored in groups standard and TFG-II (3.47±0.28 and 3.02±0.34) compared to UC. However, the restoration did not reach a significantvalue in the TFG-I group (Fig.4c). The levels of GSH decreased in the UC group. GSH levels significantly increased (P<0.01) in standard, TFG-I, and TFG-II (6.17±0.51, 4.47±0.23, and 5.13±0.7) groups, respectively compared to UC. However, the restoration was not complete in the TFG-I group, as the levels were significantly (P<0.01) lower when compared to normal control(Fig.4d). The levels of MDA wereincreasedin the UC group. MDA levels significantly (P<0.01) decreased in standard, TFG-I, and TFG-II (624.7±55.27, 1194± 61.25, and 699.2±74.87) compared to the UC group. However, the levels were significantly higher (P<0.05) in standard, TFG-I, and TFG-II compared to the normal control (Fig.4e). The pro-inflammatory cytokine TNF-α levels were decreased significantly (P<0.01) in standard, TFG-I, and TFG-II (-1.756 ±0.007, -0.2742±0.17 and -0.5180±0.002) compared to the UC group (0.20±0.02).(Fig. 4f).
Fig. 4. Effect of aqueous extract of Trigonellafoenum-graecum L. seeds on tissue levels of a) TP, b) CAT, c) SOD, d) GSH, e) LPO and f) TNF-α levels in Normal control, UC, and rats treated with 100mg/kg of standard and aqueous extract of TFG at 500mg/kg and 1000mg/kg. Significant difference: *P < 0.05 and **P < 0.01 compared to Control; aP < 0.05 and bP < 0.01 compared to UC.
DISCUSSION:
The present study has demonstrated the beneficial effect of TFG in UC in rats. The aqueous extract of TFGseeds has shown protection against colitis in rats, as evidenced by colonic length, weight, DAI, gross, histological, and biochemical evaluations.
The colonic weight/length ratio indicates the intestinal inflammation with the consequent shortening of the colon length and increase in weight. There was a significant reduction in the colonic weight/length ratio in groups treated with TFG, which indicates its anti-inflammatory property. DAI, which assesses the disease severity as described by Cooper et al. (1993)20, is a combined score of weight loss, rectal bleeding, and stool consistency.It was assessed after colitis induction. The DAI score was significantly decreased in groups treated with sulfasalazine and TFG indicating their ability to diminish the intensity of inflammation in ulcerative colitis. In concordance, a similar study investigated the effect of dietary fenugreek on inflammation in dextran sulphate sodium (DSS)-induced colitis model, reported: significant improvement in DAI scores in fenugreek treated groups compared to positive control; reduction in colon/length ratio and the tissue levels of inflammatory cytokines29.
The extent of inflammation and ulceration was assessed macroscopically by Morris et al. (1989)21 and microscopically by Galvez et al. (2001)22. The macroscopic score was maximum at 4.7 in UC- group and significantly decreased in standard drug and TFG treated groups. Similarly, a microscopic score that quantitatively measures severity by assessing the depth and extent of ulceration and inflammation in different layers ofthe affected colon, was found to be reduced in TFG treated groups. Various studies have reported the anti-inflammatory property of TFG and tried to demonstrate the anti-inflammatory mechanisms. A similar study evaluated the TFG and caraway in aqueous or oil seeds extract in an acetic acid induced UC model in rats. The study concluded that the administration of aqueous extract of TFG reducedinflammatory mediators compared to the UC group30.
TNF-α is an inflammatory marker implicated in the pathogenesis of UC. Studies have shown its production is upregulated in colon tissue in IBD and the levels closely correlate with mayo endoscopic score (severity of UC). Its importance is proven by robust improvement in symptoms observed following anti-TNFα antibody therapy in refractory or immunosuppressive intolerant cases31-33. In the present experiment, treatment with TFG effectively diminished TNF-α gene expression, which could explain the decreased intensity of colonic inflammatory reaction observed in the group. The findings were similar and consistent with another study that showed administration of dietary TFG in the DSS colitis model in mice significantly reduced the levels of TNF-α, IL-1β,IL-6, and increased anti-inflammatory cytokine IL-10 in colon tissue29. A study by Kawabata et al. (2011)34 investigated the inhibitory effects of TFG seeds on inflammatory cytokine TNF-α in in-vitro cell lines. The study concluded that steroidal saponins in TFG were responsible for the inhibitory effects and found its half-maximal inhibitory concentration (IC-50) to be 22.7 microgm/ml.All these studies consistently showed the ability of TFG in decreasing the TNF-α levels.
Rats treated with TFG showed a significant increase in total protein levels when compared to the UC group. Consistent with our finding another study that evaluated the antidiabetic effect of TFG seed extract in diabetic rats found restoration of total proteins following therapy with TFG by oral route35. The reason for the rise in tissue proteins with TFG is not known but could be due to its significant anabolic and androgenic activity and its nutrient value.It was shown to be rich in proteins (26%) apart from dietary fiber (48%)36.
Oxidative stress plays an important role in the occurrence and progression of UC37. The mucosal damage found in IBD is due to increased oxidative stress and decreased antioxidant defence38,39. Oxidative stress is known to cause mucosal damage in IBD40. Rats treated with TFG showed protection against lipid peroxidation by demonstrating a significant decrease in MDA levels and a rise in antioxidant levels (GSH, CAT, and SOD).Consistent with our findings,another study found decreased MPO levels by 30.5% and increased antioxidants mainly SOD enzyme levels by 35% in aqueous extract of fenugreek seed group compared to the disease control group30. The previous report confirms the natural antioxidantability of flavonoids41. The increased levels of antioxidants following TFG could be attributed to flavonoid, vitamin E and other natural antioxidant components like trigonelline and choline alkaloids42,43.
CONCLUSION:
Our study demonstrates the beneficial effects of Trigonellafoenumgreacum L. in attenuating the acetic acid-induced colitis in a rat model. The study confirms the ability of TFG seeds in reducing the inflammatory and oxidative-induced mucosal damage in UC.
REFERENCES:
1. Alatab S, Sepanlou SG, Ikuta K, Vahedi H, Bisignano C, Safiri S, Sadeghi A, Nixon MR, Abdoli A, Abolhassani H, Alipour V. The global, regional, and national burden of inflammatory bowel disease in 195 countries and territories, 1990–2017: a systematic analysis for the Global Burden of Disease Study 2017. The Lancet gastroenterology &hepatology. 2020; Jan 1;5(1):17-30.https://doi.org/10.1016/S2468-1253(19)30333-4
2. Samyuktha G, Charan SN. Effect of Methanolic seed extract of Piper nigrumaganist Acetic acid induced Ulcerative colitis in rats. Res J Pharmacolog Pharmacodynamics. 2019 May 28;11(2):62-6.doi: 10.5958/2321-5836.2019.00011.9
3. Fonseca-Camarillo G, Yamamoto-Furusho JK. Immunoregulatory pathways involved in inflammatory bowel disease. Inflammatory bowel diseases. 2015 Sep 1;21(9):2188-93.https://doi.org/10.1097/MIB.0000000000000477
4. Fournier BM, Parkos CA. The role of neutrophils during intestinal inflammation. Mucosal Immunol. 2012 Jul;5(4):354-66. doi: 10.1038/mi.2012.24
5. Nikolaus S, Bauditz J, Gionchetti P, Witt C, Lochs H, Schreiber S. Increased secretion of pro-inflammatory cytokines by circulating polymorphonuclear neutrophils and regulation by interleukin 10 during intestinal inflammation. Gut. 1998 Apr; 42(4):470-6. doi: 10.1136/gut.42.4.470
6. Zhou GX, Liu ZJ. Potential roles of neutrophils in regulating intestinal mucosal inflammation of inflammatory bowel disease. J Dig Dis. 2017 Sep;18(9):495-503. doi: 10.1111/1751-2980.12540
7. Weigmann B, Neurath MF. Th9 cells in inflammatory bowel diseases. SeminImmunopathol. 2017 Jan;39(1):89-95. doi: 10.1007/s00281-016-0603-z
8. Rajput CG. Formulation and Evaluation of Fenugreek powder as Nutraceutical from seeds of Trigonellafoenumgraecum. Research Journal of Pharmacognosy and Phytochemistry. 2021 Apr 1;13(2):78-80.doi: 10.52711/0975-4385.2021.00013
9. Shashikumar JN, Champawat PS, Mudgal VD, Jain SK. Role of fenugreek (Trigonellafoenumgraecum) on in management of diabetes disease. Journal of Pharmacognosy and Phytochemistry. 2019;8(4):184-7.
10. Żuk-Gołaszewska K, Wierzbowska J. Fenugreek: productivity, nutritional value and uses. J Elementol. 2017 Sep 1;22(3):1067-80.
11. Khorshidian N, YousefiAsli M, Arab M, AdeliMirzaie A, Mortazavian AM. Fenugreek: potential applications as a functional food and nutraceutical. Nutrition and Food Sciences Research. 2016 Feb 10;3(1):5-16.
12. Fatima T, Maqbool K, Hussain SZ. Potential health benefits of fenugreek. Journal of Medicinal Plants Studies. 2018;6(2):166-9.
13. Noor EA. Comparative study on the corrosion inhibition of mild steel by aqueous extract of Fenugreek seeds and leaves in acidic solutions. Journal of Engineering and Applied sciences. 2008 Jan;3(1):23-30.https://doi.org/10.3923/jeasci.2008.23.30
14. Mathew MM, Han NV, Murugesan A, Raj EA, Prasanth KG. Evaluation of the protective effect of Pterocarpus marsupium on acetic acid-induced ulcerative colitis in rats. Inflammopharmacology. 2015 Aug;23(4):195-201. doi: 10.1007/s10787-015-0234-3
15. Muralidhara, Narasimhamurthy K, Viswanatha S, Ramesh BS. Acute and subchronic toxicity assessment of debitterized fenugreek powder in the mouse and rat. Food ChemToxicol. 1999 Aug;37(8):831-8. doi: 10.1016/s0278-6915(99)00076-9
16. Joshi DV, Patil RR, Naik SR. Hydroalcohol extract of Trigonellafoenum-graecum seed attenuates markers of inflammation and oxidative stress while improving exocrine function in diabetic rats. Pharm Biol. 2015 Feb;53(2):201-11. doi: 10.3109/13880209.2014.913296
17. Afroz, R., khan, M. I., Rahman, K. A., Lotus, M. J., Shahabuddin, M. muhammad S., Afrin, T., Yeasmin, N., & Moon, K. J. Histopathological Evaluation of Gastro Protective Effect of TrigonellaFoenumGraecum Seed (Methi) and omeprazole in Experimentally Induced Gastric Ulcer in Rats. Journal of Dhaka Medical College. 2020; 28(1), 67–75. https://doi.org/10.3329/jdmc.v28i1.45759
18. Mousavizadeh K, Rahimian R, Fakhfouri G, Aslani FS, Ghafourifar P. Anti-inflammatory effects of 5-HT receptor antagonist, tropisetron on experimental colitis in rats. Eur J Clin Invest. 2009 May;39(5):375-83. doi: 10.1111/j.1365-2362.2009.02102.x.
19. Aleisa AM, Al-Rejaie SS, Abuohashish HM, Ola MS, Parmar MY, Ahmed MM. Pretreatment of Gymnemasylvestre revealed the protection against acetic acid-induced ulcerative colitis in rats. BMC Complement Altern Med. 2014 Feb 10;14:49. doi: 10.1186/1472-6882-14-49
20. Cooper HS, Murthy SN, Shah RS, Sedergran DJ. Clinicopathologic study of dextran sulfate sodium experimental murine colitis. Lab Invest. 1993 Aug;69(2):238-49. http://europepmc.org/abstract/MED/8350599
21. Morris GP, Beck PL, Herridge MS, Depew WT, Szewczuk MR, Wallace JL. Hapten-induced model of chronic inflammation and ulceration in the rat colon. Gastroenterology. 1989 Mar;96(3):795-803.https://doi.org/10.1016/S0016-5085(89)80079-4
22. Gálvez J, Coelho G, Crespo ME, Cruz T, Rodríguez-Cabezas ME, Concha A, Gonzalez M, Zarzuelo A. Intestinal anti-inflammatory activity of morin on chronic experimental colitis in the rat. Aliment Pharmacol Ther. 2001 Dec;15(12):2027-39. doi: 10.1046/j.1365-2036.2001.01133.x.
23. Lovrien R, Matulis D. Assays for total protein. Current protocols in protein science. 1995 Sep;1(1):3-4.https://doi.org/10.1002/0471140864.ps0304s01.
24. Rahman I, Kode A, Biswas SK. Assay for quantitative determination of glutathione and glutathione disulfide levels using enzymatic recycling method. Nat Protoc. 2006;1(6):3159-65. doi: 10.1038/nprot.2006.378.
25. Aebi H. Catalase in vitro. Methods Enzymol. 1984;105:121-6. doi: 10.1016/s0076-6879(84)05016-3
26. Kuninaka S, Ichinose Y, Koja K, Toh Y. Suppression of manganese superoxide dismutase augments sensitivity to radiation, hyperthermia and doxorubicin in colon cancer cell lines by inducing apoptosis. Br J Cancer. 2000 Oct;83(7):928-34. doi: 10.1054/bjoc.2000.1367
27. Ohkawa H, Ohishi N, Yagi K. Assay for lipid peroxides in animal tissues by thiobarbituric acid reaction. Anal Biochem. 1979 Jun;95(2):351-8. doi: 10.1016/0003-2697(79)90738-3
28. Perera PK, Li Y, Peng C, Fang W, Han C. Immunomodulatory activity of a Chinese herbal drug Yi Shen Juan Bi in adjuvant arthritis. Indian J Pharmacol. 2010 Apr;42(2):65-9. doi: 10.4103/0253-7613.64489
29. Liu MY, Hsu DZ, Periasamy S, Chien SP. Dietary fenugreek attenuates dextran sodium sulfate-induced ulcerative colitis: role of inflammation. Jpn. J. Gastroenterol Hepatol. 2019;1:1-9.
30. Elsayed M, Hussein R. A comparative study of anti inflammatory and antioxidant activities of fenugreek (TrigonellaFoenumGraecum) and caraway (CarumCarvi) aqueous and oil seed extracts in experimental model of ulcerative colitis. World Journal of Pharmaceutical Research. 2019 Jan 27;8:251-66.
31. Hendrickson BA, Gokhale R. Judy H. Cho Clinical aspects and pathophysiology of Inflammatory Bowel Disease: ClinMicrobiol Rev. 2002 Jan;15:79-94.https://doi.org/10.1128/CMR.15.1.79-94.2002
32. Ślebioda TJ, Kmieć Z. Tumour necrosis factor superfamily members in the pathogenesis of inflammatory bowel disease. Mediators Inflamm. 2014;2014:325129. doi: 10.1155/2014/325129.
33. Mańkowska-Wierzbicka D, Swora-Cwynar E, Poniedziałek B, Adamski Z, Dobrowolska A, Karczewski J. Usefulness of selected laboratory markers in ulcerative colitis. Eur Cytokine Netw. 2015 Apr-Jun;26(2):26-37. doi: 10.1684/ecn.2015.0363
34. Kawabata T, Cui MY, Hasegawa T, Takano F, Ohta T. Anti-inflammatory and anti-melanogenic steroidal saponin glycosides from Fenugreek (Trigonellafoenum-graecum L.) seeds. Planta Med. 2011 May;77(7):705-10. doi: 10.1055/s-0030-1250477
35. Baset ME, Ali TI, Elshamy H, El Sadek AM, Sami DG, Badawy MT, Abou-Zekry SS, Heiba HH, Saadeldin MK, Abdellatif A. Anti-diabetic effects of fenugreek (Trigonellafoenum-graecum): A comparison between oral and intraperitoneal administration-an animal study. International Journal of Functional Nutrition. 2020 Sep 1;1(1):1.https://doi.org/10.3892/ijfn.2020.2
36. Ikeuchi M, Yamaguchi K, Koyama T, Sono Y, Yazawa K. Effects of fenugreek seeds (Trigonellafoenumgreaecum) extract on endurance capacity in mice. J Nutr Sci Vitaminol (Tokyo). 2006 Aug;52(4):287-92. doi: 10.3177/jnsv.52.287
37. Kruidenier L, Verspaget HW. Review article: oxidative stress as a pathogenic factor in inflammatory bowel disease--radicals or ridiculous? Aliment PharmacolTher. 2002 Dec;16(12):1997-2015. doi: 10.1046/j.1365-2036.2002.01378.x.
38. Koutroubakis IE, Malliaraki N, Dimoulios PD, Karmiris K, Castanas E, Kouroumalis EA. Decreased total and corrected antioxidant capacity in patients with inflammatory bowel disease. Dig Dis Sci. 2004 Sep;49(9):1433-7. doi: 10.1023/b:ddas.0000042242.22898.d9
39. Bitiren M, Karakilcik AZ, Zerin M, Ozardali I, Selek S, Nazligül Y, Ozgonul A, Musa D, Uzunkoy A. Protective effects of selenium and vitamin E combination on experimental colitis in blood plasma and colon of rats. Biol Trace Elem Res. 2010 Jul;136(1):87-95. doi: 10.1007/s12011-009-8518-3
40. Rezaie A, Parker RD, Abdollahi M. Oxidative stress and pathogenesis of inflammatory bowel disease: an epiphenomenon or the cause? Dig Dis Sci. 2007 Sep;52(9):2015-21. doi: 10.1007/s10620-006-9622-2
41. Al-Rejaie SS, Abuohashish HM, Al-Enazi MM, Al-Assaf AH, Parmar MY, Ahmed MM. Protective effect of naringenin on acetic acid-induced ulcerative colitis in rats. World J Gastroenterol. 2013 Sep 14;19(34):5633-44. doi: 10.3748/wjg.v19.i34.5633
42. Patil S, Jain G. Holistic approach of Trigonellafoenum-graecum in phytochemistry and pharmacology-A review. Current Trends in Technology and Science. 2014;3(1):34-48.
43. Mizushima T, Sasaki M, Ando T, Wada T, Tanaka M, Okamoto Y, Ebi M, Hirata Y, Murakami K, Mizoshita T, Shimura T, Kubota E, Ogasawara N, Tanida S, Kataoka H, Kamiya T, Alexander JS, Joh T. Blockage of angiotensin II type 1 receptor regulates TNF-alpha-induced MAdCAM-1 expression via inhibition of NF-kappaB translocation to the nucleus and ameliorates colitis. Am J Physiol Gastrointest Liver Physiol. 2010 Feb;298(2):G255-66. doi: 10.1152/ajpgi.00264.2009.
Received on 04.03.2022 Modified on 22.08.2022
Accepted on 13.12.2022 © RJPT All right reserved
Research J. Pharm. and Tech 2023; 16(5):2161-2168.
DOI: 10.52711/0974-360X.2023.00355