Correlation Study of Alcoholic Clove extract against Streptococcus agalactiae virulence factors isolated from Neonatal patients

 

Adnan Ali Hammad1,2, Ayman A. Farrag2,3, Tarek M. Abdelghany2,  Amr A. El-Waseif2,

Saleem Obaid Gatia Almawla4

1Anbar Education Directorate, Iraqi Ministry of Education, Anbar, Iraq.

2Botany and Microbiology Dept., Faculty of Science (Boys), Al-Azhar University, Cairo, Egypt.

3Al-Azhar Center for Fermentation Biotechnology and Applied Microbiology Al-Azhar University,
11884 Nasr City, Cairo, Egypt.

4Alanbar general Health directorate, Ministry of health, Anbar, Iraq.

*Corresponding Author E-mail: adad15693@gmail.com

 

ABSTRACT:

Plant extracts promise natural sources of antivirulence chemicals thanks to their broad availability and various phytochemical antivirulence components. The main antivirulence components of plants are essential oils. 130 isolates were obtained from neonates (≤1 year old) from February, 2020 to February, 2021. All studied isolates were diagnosed by traditional methods like biochemical tests, Vitek-2 system, and 16srRNA using conventional PCR. Profile of antibiotics resistance ratio for Streptococcus agalactiae were Penicillin 20%, Clindamycin 68%, Chloramphenicol 46%, Tetracycline 82%, Erythromycin 100%, Imipenem 12%, and Ciprofloxacillin 26.47%. All genes (Cyl E, Spb1, and bibA) were detected by conventional PCR and the molecular frequency showed 64% of strains positive for Cyl E gene and 56% of strains harbored bibA genes, while 48% of Streptococcus agalactiae contain Spb1 gene. This research showed the coexistence of bla Cyl E, Spb 1 and bibA genes in 48% strains of Streptococcus agalactiae. Extraction of clove extract was carried out using methanol and it analysed using GC-MS to detect active compounds, such as Eugenol (60.10%). The effect of clove extract against biofilm formation, haemolysin, and protease activity was significant (p-value < 0.01).

 

KEYWORDS: Clove extract, Cyl E, Streptococcus agalactiae,virulence factors, Spb 1, and bibA.

 

 


INTRODUCTION:

Streptococcus agalactiae (GBS) is a primary cause of serious neonatal infections1, while a frequent colonizer of a considerable proportion of the human population in the genitourinary and gastrointestinal tract2. Early infancy occurs in GBS infections, which are generally referred as the precocious disease (EOD) in the first week of life3. Late-onset (LOD) disease occurs till the 3 months of age following the first week. The main risk factor for neonatal illness development is maternal colonisation with GBS, though additional mechanisms of transmission do exist4.

 

Streptococcus agalactiae (GBS) treated by ampicillin and penicillin, which are first-line antibiotics for both intrapartum prevention and treatment of GBS infections across all age grou. However, the identification of the first GBS isolate with reduced penicillin susceptibility was reported in Japan, but its clinical significance has not been shown so far6,7,8. Reduced antibiotic efficiency, increased bacterial infection, and newly emerging microbial resistance have all become worldwide public health concerns in recent decades, necessitating an urgent need to develop effective solutions to address these issues9. Strategies that target bacterial virulence factors rather than bacterial survival have gained increased attention, as modulating virulence factors may help prevent bacteria from developing drug resistance10,11. This present study aimed to clarify the association between the antibacterial of clove oil towards Streptococcus agalactiae virulences factors.

 

MATERIALES AND METHODS:

Samples collection and bacterial diagnosis:

A collection of 130 Blood samples were aseptically from neonates for blood culture to isolate and identify Streptococcus agalactiae as a cause for sepsis isolates recovered from February, 2020 to February, 2021 in normally sterile products of neonates (≤1 year old) in Al-Anbar hospitals, Iraq, Cairo, Egypt.  All studied isolates were diagnosed by conventional tests, vitek-2 system, and molecular diagnosis using 16S rRNA12.

 

Antimicrobial susceptibility tests:

Based on Kirby–Bauer method, all GBS isolates were tested for susceptibility to Penicillin, Clindamycin, Chloramphenicol, Tetracycline, Erythromycin, Imipenem, and Ciprofloxacillin. The disk diffusion method was used to test antimicrobial susceptibility for β-hemolytic streptococci in accordance with the CLSI standards. CLSI guidelines for high level aminoglycoside resistance detection in enterococci were applied13.

 

Collection, preparation and identification of plants:

The plants Syzygium aromaticum was taken from the local plantations of the govern ate of Anbar, at 9:00 a.m. on sunny days, in April 2020 in the region of Anbar. The plant was washed with tape water to remove any adhesive material on their surfaces and then washed again with distilled water. The plant was identified by Herbarium, Desert Studies Center at Anbar University, Iraq.

 

Extraction of Syzygium aromaticum product:

At room temperature, finely powdered clove powder was extracted with 80 percent methanol (1g/10ml) in a shaker for 4 hours. The residue was extracted once again for 2 hours with 80 percent methanol. The extracted material was filtered through double-layered muslin and centrifuged at 5000g for 5 minutes to get a clear supernatant. The extract was concentrated in a vacuum evaporator and stored at a temperature of -20°C for future use14, 15.

 

Haemolysin assay :

A determination hemolytic assay in Streptococcus agalactiae was used, as previously adapted to16. Sheep erythrocytes were prepared as previously described17.

 

Protease assay :

Proteolytic activity was determined using supernatants from culture supernatants centrifuged at 12 000 g for 15 minutes at room temperature. The azocase in technique was used to determine the proteolytic activity18.

 

Biofilm formation :

A spectrophotometric technique had been used to determine adhesion cells as follows: Stock culture was prepared using trypticase soya broth. After inoculation, then incubated aerobic incubation at 35°C for 24 h19.

 

Molecular detection of Virulence profile :

Different virulence determinants, including cyl(E) (encoding cytolysin–hemolysin, spb(1) (encoding a protein involved in invasivity and adherence), and bib(A) (encoding an adhesin) were investigated by PCR using specific primers according to  (Table 1)20.

 


 

Table 1 : primers sequence of virulence factors  cyl(E), spb(1), and bib(A) .

Gene

Primers' Sequences (5'→3')

Product size (bp)

Annealing (˚C)

 

Virulence genes

 

[16]

 

Cyl (E)

F: TGACATTTACAAGTGACGAAG

300

50

R: TTGCCAGGAGGAGAATAGGA

Spb(1)

F:GCTGAGACAGGGACAATTAC

250

54

R : GTTGAAGGCAACTCAGTACC

Bib (A)

F:AATCGAAAACAACGTTGGAAAG

200

52

R:AAACCAGGCTTCATCAGTCATT

 


Antimicrobial assay:

The minimum inhibitory concentrations (MICs) of resazurin were determined according to CLSI protocols21. The quality control strain was Streptococcus pneumonia ATCC 49619.

 

RESULTS AND DISSCUSION:

Isolation and Identification :

The result showed that 25/130(19.23%) diagnosed as Streptococcus agalactiae from neonatal samples. When Streptococcus agalactiae isolates were grown on Sheep Blood agar, they appeared as glistening gray-white colonies with a small zone of beta hemolysis, whereas they presented as orange-colored colonies on Granada agar. Gram stain, catalase, and oxidase results indicated G+ dipococci, negative, and negative, respectively.

 

Result on figure (1) showed Streptococcus agalactiae isolates were cultured on Sheep Blood agar, they appeared as glistening gray-white colonies with a narrow zone of beta hemolysis, while on Granada agar they appeared as orange coloured colony :

 

Figure 1 : Streptococcus agalactiae  on A : Sheep blood agar, B : Granada agar.

 

Table (2): Morphological characteristics and biochemical tests for Streptococcus agalactiae bacterial isolates:

Test

Result

Granada agar

Orange colonies

Haemolysin 

()+

Gram-stain

G+ dipococci

Catalase test

-

Oxidase test

-

CAMP

+

VP

-

 

All results of microscopic examination and biochemical test for Streptococcus agalactiae. Result show in table (2).

 

Antibiotics Resistance test of GBS:

According to figure 2 and table 3, disc diffusion data for shown that antibiotics resistance was Erythromycin (100%), Tetracycline (82%), Clindamycin (68%), Chloramphenicol (46%), Ciprofloxacillin (26.47%), Penicillin (20%) and Imipenem (12).

 

Table 3 :The antibiogram parameter for study isolates according Kirby-Bauer technique

Antibiotics

Streptococcus agalactiae

Resistant

Intermediate

Sensitive

%

%

%

Penicillin

20

0

80

Clindamycin

68

16

16

Chloramphenicol

46

16

38

Tetracycline

82

18

0

Erythromycin

100

0

0

Imipenem

12

0

88

Ciprofloxacillin

26.47

38.23

69

*S=sensitive; I=intermediate; R=resistant


 

Figure 2 :Antimicrobial  Susceptibility test Percentage of antibiotic resistance.

 


Molecular detection of Cyl E, bib A, and Spb 1 :

The Cyl E, Spb1, and bibA genes were found using standard PCR, and the results showed that 64% of the strains tested positive for the Cyl E gene, and 56% of the strains tested positive for the bibA gene, while the Spb1 gene is found in 48 % of the Streptococcus agalactiae, figure 3. Cyl E, Spb 1, and bibA genes were found to be present in 48 % of the strains of Streptococcus agalactiae, according to these data. Molecular weight of Cyl E, Spb 1, and bibA is 300 Pb, 250 Pb, and 200 Pb respectively.

Biofilm formation :

A severe challenge for public health has been posed by the rapid emergence of various antibiotic resistance of Streptococcus agalactiae, biofilm forming capacity enhances the organism's survival and transfer in hospitals, such as on diverse surfaces such as catheters, catheter tubes, and cerebrospinal fluid shunts22, 23.

 


 

                                                  (A)                                                              (B)                                                     (C)

Figure 3 :Molecular Diagnosis of  Streptococcus agalactiae virulence genes :- A : Spb 1 ;  B: Cyl E; C: bibA

 

Figure 4: GC-MS analysis of clove extract.

 


The purpose of this study is to evaluate the use of a microtiter plate (MTP) for identifying biofilm formation in Streptococcus agalactiae from a variety of clinical samples. Ten clinical isolates were screened using a microtiter plate for the detection of biofilm development (MTP). After 24 hours of incubation, MTP determined that all isolates 10/10(100%) exhibited a biofilm-positive phenotype. The percentage of biofilm in the current study was 66.67% (strong), 25% (intermediate), and 8.33 % (weak).

 

For the seven agents encompassing the seven antimicrobial categories, aminoglycosides, cephemes, carbapenems, penicillins, folate inhibitors and tetracyclines, antibiotic resistance was determined. Only 6.4% were not biofilm producers, 15.6% were weak biofilm formers, 32.4% (50 isolates) were moderate biofilm formers, and 45.4% (70 isolates) were robust biofilm formers24,25.

 

Different antibiotic resistance levels and biofilm formation levels may be found in different locations. The primary causes influencing resistance may vary, with different locations featuring different combinations of the two. The most important evidence is that traditional theories can't explain why biofilms are so resistant to antibacterial medicines. Many significant variables contributing to the biofilm's high resilience have been examined: slow-growth rate, persistent non dividing cells, biofilm phenotypic adaptation26,27,28.

 

The biofilm formation assay was performed for all S. agalactiae isolates using a 96-well ELISA plate after an 18-hour incubation period at 0.5 light intensity and a 630 nm wavelength absorption reading.

 

Identification of the Active compounds of clove extracts by GC-Mass spectrometry:

GC-MC gas chromatography was used to examine the volatile oils to detect the active components in these plant extracts. Figure 4

Table 4: Yield and chemical composition of clove extract as identified by GC/MS analysis:

Area %

R. time

Active compound

Peak

60.10

9.342

Eugenol

3

29.3

9.768

Cyclopropane

4

 

According to GC-MASS result, Euganol rate area was 60.10%. Bioactive chemicals have antimicrobial activity against a variety of microbial diseases and may be used in place of antibiotics to combat the growing microbial resistance to antibiotics. The current work was conducted to elucidate the mechanism underlying the antibacterial action of the bioactive molecule Eugenol. Eugenol exhibited a broad spectrum of antibacterial activity against the test pathogens, with MIC values ranging from 0.0312 to 8g/mL. The compound's comparable MBC was 2-4 time greater. Within 24 hours, the time kill curve demonstrated that Eugenol efficiently reduced Streptococcus agalactiae to undetectable levels. As shown by intracellular ATP, the chemical had a disruptive effect on the cytoplasmic membrane. In the presence of divalent captions, the compound's MIC value increased, as did the bacterium's membrane depolarization. Additionally, this may allow the medication to interact with intracellular locations, resulting in cell harm.

 

Effect of clove oils on Haemolysin, Biofilm, protease activity :

Healthcare-associated Streptococcus agalactiae infections are of considerable issue, given their potential to acquire virulence factor genes. Therefore, it seems vital to shed light on the discovery of new antimicrobials and/or improve the action of antibiotics employing plant extracts against virulent Streptococcus agalactiae strains29. According to figure 5, the current results showed reducing biofilm, haemolysin, protease activity at p-value less than 0.01 because of clove oil efficiency.

 

 

Figure 5 : Effect of clove oils on some virulence factors. A : protease Activity, C : Haemolysin Activity, E : Biofilm activity, (B,C,F) : treatment with clove oil.

 


CONCLUSION:

The present study concluded that alcoholic extract from Syzygium aromaticum is effective in inhibiting virulence factors of Streptococcus agalactiae isolated from neonates in the neonatal unit of maternity and child teaching hospital in Ramadi.

 

REFERENCES :

1.      Sørensen UB. Klaas IC. Boes J. Farre M. The distribution of clones of Streptococcus agalactiae (group B streptococci) among herdspersons and dairy cows demonstrates lack of host specificity for some lineages. Veterinary microbiology. 2019; 235: 71-79: https://doi.org/10.1016/j.vetmic.2019.06.008

2.      Chen B. Chen H. Shu X. Yin Y.  Li J. Qin J. Xiang C. Presence of segmented filamentous bacteria in human children and its potential role in the modulation of human gut immunity. Frontiers in microbiology. 2018; 9: 1403: https://doi.org/10.3389/fmicb.2018.01403

3.      Gamal A. El-Noby Hassanin M. El-Hady M. Aboshabana S. Streptococcus: A review article on an emerging pathogen of farmed fishes.  Egyptian Journal of Aquatic Biology and Fisheries. 2021; 25.1: 123-139: doi: 10.21608/ejabf.2021.138469

4.      Motallebirad T. Fazeli H. Ghahiri A. Shokri D. Jalalifar S. Moghim S. Esfahani BN.  Prevalence, population structure, distribution of serotypes, pilus islands and resistance genes among erythromycin-resistant colonizing and invasive Streptococcus agalactiae isolates recovered from pregnant and non-pregnant women in Isfahan, Iran. BMC microbiology. 2021; 21.1: 1-11: https://doi.org/10.1186/s12866-021-02186-2

5.      Subramanian S. Shenoy PA. Pai V. Antimicrobial activity of some Essential oils and Extracts from Natural sources on Skin and Soft tissue infection causing microbes: An In-vitro Study. Research Journal of Pharmacy and Technology. 2021; 14.7: 3603-3609: doi: 10.52711/0974-360X.2021.00623

6.      Puopolo KM. Lynfaield R. Cummings JJ. Management of infants at risk for group B streptococcal disease. Pediatrics. 2019; 144.2: https://doi.org/10.1542/peds.2019-1881

7.      Abbas HA. Inhibition of virulence of Pseudomonas aeruginosa: a novel role of metronidazole against aerobic bacteria. Research Journal of Pharmacy and Technology. 2015; 8.12: 1640-1644: doi : 10.5958/0974-360X.2015.00295.4

8.      Altaif KI. Zharif DM. Hailat IA. Alqaisi KM. Al-Sultan II. A Study on Antibacterial sensitivity character to Piper betle: A Potential for alternative medicine. Research Journal of Pharmacy and Technology. 2021;14(9), 4920-4924: doi: 10.52711/0974-360X.2021.00855

9.      Kandhan TS. Roy A. Lakshmi T. Rajeshkumar S. Green synthesis of Rosemary oleoresin mediated silver nanoparticles and its effect on Oral pathogens. Research Journal of Pharmacy and Technology. 2019; 12.11: 5379-5382: doi : 10.5958/0974-360X.2019.00933.8

10.   Zhang D. Gan RY. Zhang JR. Farha AK. Li HB. Zhu F. Corke H. Antivirulence properties and related mechanisms of spice essential oils: A comprehensive review. Comprehensive Reviews in Food Science and Food Safety.2020; 19(3), 1018-1055: https://doi.org/10.1111/1541-4337.12549

11.   Mary R. Banu N. Inhibition of Antibiofilm Mediated Virulence Factors in Pseudomonas aeruginosa by Andrographis Paniculata. Research Journal of Pharmacy and Technology.2017; 10(1), 141-144: doi : 10.5958/0974-360X.2017.00031.2

12.   Phuoc NN. Linh NT. Crestani C. Zadoks RN. Effect of strain and enviromental conditions on the virulence of Streptococcus agalactiae (Group B Streptococcus; GBS) in red tilapia (Oreochromis sp.). Aquaculture. 2021; 534, 736256: https://doi.org/10.1016/j.aquaculture.2020.736256

13.   Melo-Cristino J. Fernandes ML. Portuguese Surveillance group for the study of Respiratory Pathogens, Streptococcus pyogenes Isolated in Portugal: Macrolide Resistance Phenotypes and Correlation with T Types. Microbial drug resistance.1999; 5(3), 219-225: https://doi.org/10.1089/mdr.1999.5.219

14.   karm IF. Investigation of active compound in Clove (Syzygium aromaticum) Extrac and compared with inhibitors of growth of some types of Bacteria causing food poisoning. Iraqi journal of agricultural sciences. 2019; 50 (6):  https://doi.org/10.36103/ijas.v50i6.855

15.   Yuldasheva  LN. Carvalho EB. Catanho MT. Krasilnikov OV. Cholesterol-dependent hemolytic activity of Passiflora quadrangularis leaves. Brazilian Journal of Medical and Biological Research. 2005; 38, 1061-1070: doi: 10.1590/s0100-879x2005000700009

16.   Krasilnikov OV. Capistrano MF.Yuldasheva LN. Nogueira RA. Influence of Cys-130 S. aureus alpha-toxin on planar lipid bilayer and erythrocyte membranes. The Journal of membrane biology.1997; 156(2), 157-172: https://doi.org/10.1007/s002329900198

17.   Zhang D. Palmer J.Teh KH. Calinisan MM Flint S. Milk fat influences proteolytic enzyme activity of dairy Pseudomonas species. International journal of food microbiology. 2020; 320, 108543: https://doi.org/10.1016/j.ijfoodmicro.2020.108543

18.   Rosini R. Margarit I. Biofilm formation by Streptococcus agalactiae: influence of environmental conditions and implicated virulence factors. Frontiers in cellular and infection microbiology. 2015; 5: 6:  https://doi.org/10.3389/fcimb.2015.00006

19.   Iseppi R. Tardugno R. Brighenti V. Benvenuti S. Sabia C. Pellati F. Messi P. Phytochemical Composition and In Vitro Antimicrobial Activity of Essential Oils from the Lamiaceae Family against Streptococcus agalactiae and Candida albicans Biofilms. Antibiotics. 2020; 9(9), 592:  https://doi.org/10.3390/antibiotics9090592

20.   López Y. Parra E. Cepas V. Sanfeliú I. Juncosa T. Andreu A. Soto SM. Serotype, virulence profile, antimicrobial resistance and macrolide-resistance determinants in Streptococcus agalactiae isolates in pregnant women and neonates in Catalonia, Spain.  Enfermedades infecciosas y microbiologia clinica.2018; 36(8), 472-477: https://doi.org/10.1016/j.eimce.2017.08.019

21.   Zheng JX. Chen Z. Xu ZC. Chen JW. Xu GJ. Sun X. Qu D. In vitro evaluation of the antibacterial activities of radezolid and linezolid for Streptococcus agalactiae. Microbial pathogenesis. 2020; 139, 103866.‏ https://doi.org/10.1016/j.micpath.2019.103866

22.   Smani Y. McConnell MJ. Pachón J. Role of fibronectin in the adhesion of Acinetobacter baumannii to host cells. PLoS One. 2012; 7(4): https://doi.org/10.1371/journal.pone.0033073

23.   Salman SA. Aldeen WR. Antibacterial, Anti-virulence factors of Hibiscus sabdariffa extracts in Staphylococcus aureus isolated from patients with urinary tract infection. Research Journal of Pharmacy and Technology. 2018; 11(2), 735-740: doi : 10.5958/0974-360X.2018.00138.5

24.   Yang CH. Su PW. Moi SH. Chuang LY. Biofilm formation in Acinetobacter baumannii:  genotype-phenotype correlation. Molecules. 2019; 24(10), 1849: https://doi.org/10.3390/molecules24101849

25.   Reddy GS. Srinivasulu K. Mahendran B. Reddy RS. Biochemical characterization of anti-microbial activity and purification of glycolipids produced by dodecanoic acid-undecyl ester. Research Journal of Pharmacy and Technology. 2018; 11(9), 4066-4073: doi : 10.5958/0974-360X.2018.00748.5

26.   Stowe  SD. Richards JJ. Tucker AT. Thompson R. Melander C. Cavanagh J. Anti-biofilm compounds derived from marine sponges. Marine Drugs. 2011; 9(10), 2010-2035:  https://doi.org/10.3390/md9102010

27.   Mohammed GJ. Abdul-Razaq MS. Grouping and Revelation the significant Virulence genes of Escherichia coli isolated from Patients with Urinary Tract Infections. Research Journal of Pharmacy and Technology. 2018; 11(12), 5483-5489: doi : 10.5958/0974-360X.2018.00999.X

28.   Mussa A. Ziayt M. Study the effect of Purified Pyoluteorin Produced from P. aeruginosa, Isolated from Rhizospheric Plant Wheat on some UTI Bacteria Biofilm Formation. Research Journal of Pharmacy and Technology. 2018; 11(12), 5529:‏ doi : 10.5958/0974-360X.2018.01006.5

29.   Ju J. Xie Y. Yu H. Guo Y. Cheng Y. Qian H. Yao W.  Synergistic interactions of plant essential oils with antimicrobial agents: a new antimicrobial therapy. Critical Reviews in Food Science and Nutrition. 2020; 1-12: https://doi.org/10.1080/10408398.2020.1846494

 

 

 

Received on 26.09.2021           Modified on 19.11.2021

Accepted on 21.12.2021         © RJPT All right reserved

Research J. Pharm. and Tech. 2022; 15(7):3159-3164.

DOI: 10.52711/0974-360X.2022.00528