INTRODUCTION:

Bacterial infections are one of the prominent problems causing death, health troubles and physical disabilities all over the world. The increasing attention in the use of alternative therapeutic agents is the result of the progressive resistance in bacteria against antibiotic becoming a major obstacle as well as because people are suffering in sometimes-severe side effects of many antibiotics be adequate to give rise to an aversion to many synthetic drugs⁽¹⁾.

There is a vital need for alternative therapies development from various natural sources including algae⁽²⁾. Algae are now having greater attention following the increase in demand for biodiversity in the broadcast programs looking for therapeutic drugs from natural sources.

Especially, Both of the bio- active compounds and substances with nutritive values various algae have been illustrated^{(3, 4)}. Algae used in traditional medication for a long time and some algae demonstrated to have bactericidal, bacteriostatic, antiviral, antifungal, and anticancer activities⁽⁵⁾. Cyanobacteria belonging to microalgae of the class of highly appreciated constituents such as vitamins and this group of microalgae, known as a rich protein source than any other single-cell protein, vitamins, and minerals. etc., numerous strains of Cyanophyta are well known for different activities such as antimicrobial, algaecide, antiviral⁽⁶⁾. Spirulina platensis is a microscopic, filamentous, multicellular, alkalo-philic, blue-green alga. Spirulina platensis is gaining more and more care, not only for the nutritive value but also for using in the development of potential pharmaceutical agents due to its ease of cultivation, growth, harvesting, and an easily digestible cell wall ⁽⁷⁾.

Chakraborty et al. ⁽⁸⁾ reported that Spirulina platensis extract showed potential antibacterial activity against multiple drug-resistant (MDR) bacteria. The emergence of (MDR) has become public in the world population due to disordered uses of antibiotics. (MDR) bacteria compel severe conditions threatening human life through systematic infections and later be fatal to the human being ^(9,
10). Thus, it is required as a crucial need for formulating new kinds of inexpensive and less toxic agents.

The present study aimed to compare between antibacterial activity of hot and cold methanolic extract of SP against some (MDR) Gram-positive &Gram-negative bacteria and to assess the main biologically active metabolic compounds that obtained from SP by using these two extraction methods.

MATERIALS AND METHOD:

Collection, isolation and purification of algae:

The samples have collected from fresh water source from Tigris River in Baghdad. This station is located on latitude (20°33'33.55"N) and longitude (20°44'45.58"E E), algae have been streaked in plates and purified according to the procedure described by ⁽¹¹⁾. After the purification, cyanobacteria can be obtained. It was transferred into Zarrouck nutrient solution within a 250 ml sterile flask and incubated for 2-3 weeks according to the method of ⁽¹²⁾ to get appropriate growth. Culturing of algal isolates is necessary to sustain the viability of the uni-algal growth. Obtained pellets used for extraction.

Identification of algal isolates:

Obtained cyanobacterial isolates were identified according to its morphological features with aid of classical algal classification reference ⁽¹³⁾. For further identification, the PCR technique was accomplished using a set of primers (PCβF: GGCTGCTTGTTTACGCGACA and PCαF: CCAGTACCACCAGCAACTAA .This set of primers produced gen fragment (650 bp.) from operon that encodes for phycocyanin pigment. These primers used to approve the presence of cyanobacterial genome ⁽¹⁴⁾. As a negative control, authors used the chlorophyte genome. DNA was extracted and PCR reaction was programmed according to⁽¹⁵⁾.

Preparation of hot methanolic algal extracts:

S. platensis isolate was cultivated in bioreactors with Zarrouck medium to obtain a high concentration of cells. After 2 weeks in aerated bioreactors. After centrifugation, Cells were collected and used for extraction. Then fresh algal biomass have exposed to extraction using70% methanol, by Soxhlet according to⁽¹⁶⁾.

Preparation of cold methanolic algal extracts:

Cold methanolic algal extract was prepared by maceration in solvent 70% methanol according to ⁽¹⁷⁾.

Bacteria Used for Antagonistic Activity:

Bacterial isolates that used to investigate the antibacterial activity of hot and cold methanolic extracts of Spirulina platensis collected from the laboratory of high graduate in the biology department/college of science/Mustansiriyah University. These microorganisms include (Staphylococcus aureus and Streptococcus sp.) as Gram-positive models and (Pseudomonas aeruginosa, Escherichia coli, Klebsiella sp., and Serratia marscesence) as Gram-negative models. These bacteria derived from different clinical sources. The strains of bacteria have maintained on nutrient agar slants at 4°C.

Bioactivity Test of hot and cold methanolic extracts of Spirulina platensis against tested bacteria:

The antibacterial activity of four concentrations of each methanolic algal extracts (hot and cold) was tested (100, 75, 50, 25 mg/ml.) in vitro by using well diffusion method according to⁽¹⁸⁾.

Antibiotic sensitivity Assay:

Antibiotic sensitivity tests were performed in vitro for five different antibiotics (Gentamycin, levofloxacin, Netilimicin, Meropeneme, Cefixime) against tested bacteria by using the disc diffusion method ⁽¹⁹⁾.

Gas Chromatography-Mass Spectrometry:

The compounds were detected by Gas Chromatography-Mass Spectrometry (SHIMADZU—Japan) and identified by comparison of their mass with NIST library search and authentic standards as described in ⁽²⁰⁾.

RESULTS AND DISCUSSION:

Identification of algal isolates:

The micro-algal samples were identified based on the morphological characterization, the cells of microalgae were observed in the optical microscope (Figure 1) The major characterized morphological feature of Spirulina platensis is multicellular cylindrical trichrome, non-heterocystous filament is arranged in an open helix shape with evident cross-walls .

Figure 1: Microscopic morphology of isolated Spirulina platensis (40x).

For further identification, the gene fragment of phycocyanin operon harboring the IGS (cpcBA-IGC) from isolated Spirulina was successfully amplified and produced 650 bp. amplicon after it was analyzed in gel electrophoresis (Figure 2) while there was no amplification product for tested chlorophyte. When analyzed in, these results confirming the presence of cyanobacterial genomic DNA from isolated Spirulina.

Figure 2: Showing gel electrophoresis in Agarose (1.5%), 5 V/cm after 2 hr., stained with ethidum bromide and visualized under a UV transilluminator (A): amplified cpcBA-IGC (650bp.) Lane 1: isolated Spirulina platensis, Lane 2: negative control (chlorophyte)., M:100 bp. DNA ladder

Figure 3: diameters of inhibition zones of hot alcoholic extract from Spirulina platensis against studied bacteria

Figure 4: diameters of inhibition zones of cold alcoholic extract from Spirulina platensis against studied bacteria

Evaluation of Antibacterial Activity:

The antibacterial activity of Spirulina platensis crude hot methanolic extracts documented in (Figure 2). The inhibition zones ranged between (25.3±0.5-15±0.2mm.) the highest was against Staph. aureus at concentration 100mg/ml and the lowest was against Klebsiella sp. at concentration 50 mg/ml. While crude cold methanolic extracts of Spirulina platensis exhibited less effect against tested bacteria. As shown in (Figure 3) inhibition zones ranged between (14.6±0.5-12±1mm) the highest was against Staph. aureus at concentration 100mg/ml and the lowest was against Streptococcus at concentration 25 mg/ml .no zone of inhibition have seen for both hot and cold extracts against E. coli and Pseudomonas aeruginosa. In addition, no zone of inhibition has seen in control (di-methyl sulfoxide) against all tested bacteria.

As reported by ⁽²¹⁾, in most cases, Gram-positive bacterial species are the most target of secondary metabolites produced from cyanobacteria. These might be due to the genetically or chemically differences between these microbes, the antagonistic chemicals (both bactericidal and statistics), are need a appropriate medium for entrance inside the germs and destroying the cell membrane or protein biosynthesis units (RNA and DNA), in Gram-positive; this is more easy as compared with Gram-negative due to the presence of cell membrane consisting of double layers which is separated due to periplasmic space ⁽²²⁾.

Cyanobacteria are considered a promising natural source for antibacterial substances that have different modes of action ⁽²³⁾. These impacts of algal extract towards pathogens are different upon extract type, as well as microbial species. Many investigations have attempted to establish antimicrobial activity of Spirulina platensis towards many pathogenic microbes with different extraction protocols, furthermore, many reports mentioned that the antimicrobial activity of algal metabolites depend upon the type of solvent used in extraction ⁽²⁴⁾.

Figure 5: antibacterial activity of Spirulina platensis ,well No.1,2,3,4:100,75,50,25 mg /ml of hot methanolic extract respectively, No.5,6,7,8:100,75,50,25 mg /ml of cold methanolic extract respectively, middle well: control negative(DMSO).

The findings of current study indicated that the antibacterial effect of the hot methanolic crude extract is more potent than this of cold extract⁽²⁵⁾ mentioned that elevated temperatures increase the solubility and dispersion thus, the increase in extraction duration in a firm time range leads to increases in extraction efficiency. However, time Increasing will not adopt the extraction efficiency after the solute has reached to an equilibrium point inside and outside the solid material.

Antibiotic sensitivity Assay:

The data of the results of the Antibiotic sensitivity test for the current study displayed in Table1. Tested Antibiotic exhibited various antibacterial ranges during this study. The maximum inhibition zone was (34 mm.) obtained by Gentamycin against streptococcus sp. minimum inhibition zone (14 mm.) have been recorded by the previous antibiotic and Netilimicin against Pseudomonas aeruginosa. While no antibacterial, activity detected by using Cefixime against all tested bacteria. Incomparable to the activity of crude extracts of Spirulina platensis against tested bacteria.

Since drug-resistant pathogens pose an expanding argue to global health, antimicrobial agents with pharmacological modes of action that differ to the traditional antibiotics must be developed in order to compete the rise in global bacterial resistance ⁽²⁶⁾.

Numerous screening studies have been accomplished over the past years to discover new antibiotic or cytotoxic metabolic compounds of microalgae particularly cyanobacteria and green algae ⁽²⁷⁾. In the current study crude extract of Spirulina platensis has shown broad-spectrum activity toward both gram-Positive and gram-Negative bacteria. Moreover, Spirulina has proven to possess good acceptance as of its organoleptic possessions, thus making it a possible vision for a nutrition supplement and it has not displayed either chronic or acute toxic effects, making Spirulina safe for human utilization.

For all above, spirulina could be used as an alternative treatment against various infectious diseases caused by gram-positive and gram-Negative bacterial pathogens.

Gas Chromatography-Mass Spectrometry:

Sixty-three compounds identified via GC-MS analysis in hot alcoholic Spirulina extract (Figure 5). Most of these components possess various biological activities. Fourteen compounds of them exhibited antimicrobial and especially antibacterial activity. While only six chemical compounds detected from the cold alcoholic extract of Spirulina platensis by GC-MS analysis (Figure 6).four of these compounds exhibited antimicrobial activity. The difference of extracted compounds may due to the efficiency of the extraction method, Maceration is a very simple extraction procedure with lower efficiency than Soxhlet⁽²⁷⁾. Data presented in Table 2 and 3.

Table 1: Results determined in mm, of antibiotic sensitivity test against tested bacteria

Antibiotic	Tested bacteria
Antibiotic	*Pseudomonas*	*Streptococcus.*	*Staphylococcus*	*Klebsiella.*
Gentamycin	14	34	23	17
Levofloxacin	18	28	30	25
Netilimicin	14	30	20	18
Meropeneme	25	30	30	25
Cefixime	R	R	R	R

*R: resistant.

Figure 6: GC-Mass spectrophotometery chromatogram presented the hot 70% methanolic extract of Spirulina platensis

Table 2: Main Phyto-compounds and its biological activities identified through the GC/MS Study of Spirulina platensis hot methanolic extract

Peak No.	Compound name	Retention time (R.T)	Area%	Biological activity	Reference No.
1	Propylene Glycol	2.486	0.95	Antibacterial	28
4	N-Methyl-N-methoxyacetamide	8.722	14.35	Anti-mycobacterial antimicrobial, inhibitor of anthrax lethal factor, anti-inflammatory	29
7	Tridecena	10.588	0.30	Antibacterial	30
15	Pentadecanoic acid	19.463	1.14	Antibacterial	31
17	Eicosanoic acid	21.782	0.83	Antimicrobial, antioxidant	32
18	Glycerin	23.765	7.33	Antibacterial	33
19	Phytol 2-Hexadecen-1-ol	24.069	0.24	Antimicrobial,Anti-inflammatory anticancer diuretic preventive and therapeutic results arthritis	34
20	cis-10-Nonadecenoic acid	24.523	0.83	Antibacterial-	35
22	cis-Vaccenic acid	24.880	3.41	Antimicrobial &inflammatory	36
24	Pentadecanoic acid	26.581	0.28	Antibacterial	31
27	Tetradecenal	28.582	1.44	Antibacterial	37
30	8-hexadecyn-1-o	30.620	21.87	Anti-inflammatory Antimicrobial	37
32	Farnesol	31.737	2.49	Antibacterial	38
36	:2H-1-Benzopyran-6-sulfonamide	35.729	1.06	Antibacterial Antiviral	39

Figure 7: GC-Mass spectrophotometery chromatogram presented the cold 70% methanolic extract of Spirulina platensis

Table 3: Main Phyto-compounds and its biological activities identified through the GC/MS Study of Spirulina platensis cold extract

Peak No.	Compound name	Retention time (R.T)	Area%	Biological activity	Reference No.
2	Methyl vinyl sulfone	4.347	50.04	antibacterial, antifungal, antimalarial, anti-HIV	40
3	Silane	4.577	47.76	Antibacterial, antifungal	41
4	Dimethylhexylamine	13.377	1.2	Antibacterial anti-fungal	42

CONCLUSIONS:

During this study, the authors suggested that hot alcoholic extract of Spirulina platensis a good and safe choice to treat diseases caused by multi drug-resistant human pathogenic bacteria.

ACKNOWLEDGEMENTS:

The authors would like to thank Mustainsiriyah University (www. uomustansiriyah.edu.iq) Baghdad Iraq for its providing support in the current work.

SOURCE OF FUNDING:

Self fund.

CONFLICT OF INTEREST:

No conflict of interest.

ETHIC STATEMENT:

The researchers already have ethical clearance from all required institution and laboratories

REFERENCES:

1. Ali HI, Doumandji A. Comparative phytochemical analysis and in vitro antimicrobial activities of the cyanobacterium Spirulina platensis and the green alga Chlorella pyrenoidosa: potential application of bioactive components as an alternative to infectious diseases. Bulletin de l’Institut Scientifique, Rabat, Section Sciences de la Vie. 2017; 39, 41-49.

2. Prakash JW, Antonisamy JM, Jeeva S. Antimicrobial activity of certain fresh water microalgae from Thamirabarani River, Tamil Nadu, South India. Asian Pacific Journal of Tropical Biomedicine. 2011; 1(2): S170- S173. https://doi.org/10.1016/S2221-1691(11)60149-4.

3. Fernando IPS, Nah JW, Jeon YJ. Potential anti-inflammatory natural products from marine algae. Environment Toxicology and Pharmacology. 2016; 48: 22-30. https://doi.org/10.1016/j.etap.2016.09.023.

4. Yosboonruang A, Duangai A, Amormlermlerdpison D, Viyoach J. Screening for Biological Activities of Spirogyra neglecta Water Extract. Walailak Journal of Science and Technology. 2018; 17(4): 359-368. https://doi.org/10.48048/wjst.2020.4638.

5. Justo GZ, Silva MR, Queiroz MLS. Effects of green algae chlorella vulgaris on the response of the host hematopoietic system to intraperitoneal ehrlich ascitestumour transplantation in mice. Immunopharmacology Immunotoxicology. 2001; 23(1): 119-132. https://doi.org/10.1081/IPH-100102573.

6. Jensen S, Knutsen G. Influence of light and temperature on photoinibition of photosynthesis in Spirulina platensis. Journal of Applied Phycology. 1993; 5: 495-504. https://doi.org/10.1007/BF02182508.

7. Usharani G, Srinivasan G, Sivasakth S, Saranraj P. Antimicrobial Activity of Spirulina platensis Solvent Extracts Against Pathogenic Bacteria and Fungi. Advances in Biologcal Research. 2015; 9(5): 292-298. DOI: 10.5829/idosi.abr.2015.9.5.9610.

8. Chakraborty B, Jayaswal RP, Pankaj PP. Evaluation of Antibacterial Activity of Spirulina platensis extracts against opportunistic pathogen model. International Journal of Pharmaceutical and Phytopharmacological Research. 2014; 6(4): 988-990.

9. Chakraborty K, Lipton AP, Paulraj R, Chakraborty RD. Guaiane sesquiterpenes from seaweed Ulva fasciata Delile and their antibacterial properties. European Journal of Medicinal Chemistry 2010; 45(6): 2237-2244. https://doi.org/10.1016/j.ejmech.2010.01.065.

10. Bouhlal R, Riadi H, Bourgougnon N. Antiviral activity of the extracts of Rhodophyceae from Morocco. African Journal of Biotechnology. 2010; 9(46): 7968-7975.

11. Stein JR. Editor. Handbook of Phycological Methods, Culture Methods and Growth Measurements. Cambridge University Press. Cambridge (1973).

12. Jawad AL. Interactions Between Cyanobacteria and Other Microorganisms Ph.D. Thesis to Liverpool University, 1982. pp 123-125.

13. Desikachary TV. Cyanophyta. Indian Council of Agricultural Research, New Delhi, 1959. pp 686.

14. Nguyen LT, Moestrup O, Daugbjerg N. Planktonic cyanobacteria from freshwater localities in Thuathien-Hue province, Vietnam III. Phylogenetic inference based on partial phycocyanin sequences, morphological and toxicological character. Journal of Algological Studies. 2014; 144: 19–43. DOI: 10.1127/1864-1318/2014/0116.

15. Fayyad RJ , Dwaish AS. Molecular and Environmental Studies of Some Algae in Three Drinking Water plant Stations in Baghdad Province. Ms.C. thesis. College of science, Mustansiriyah University. Baghdad, Iraq. 2016; pp.50-55.

16. Vishnu KA, Aadil AI, Hameedullah SS. Antibacterial activity of the extracts obtained from Eclipta alba Hassk and Andrographis lineate against human pathogens. Journal of Pharmacy Research. 2013; 3(10): 2529-2532.

17. Priadarshini A, Pankaj PP, Varma MC, Kumar K. Evaluation of the antibacterial potential of Moringa oleifera and Azadirachta indica against some pathogenic microbes: A comparative study. International Journal of Drug Development and Research. 2013; 5(1), 214-218.

18. Clinical and Laboratory Standards Institute (CLSI): 2007. Performance for antimicrobial Susceptibility.

19. Sreenivasa R, Parekh KS. Antibacterial activity of Indian seaweed extracts, Botanica Marina. 1981; 24: 577-582.

20. Mohammed-ali AN, Fayyad RJ, Dwaish AS, Al-aboodi AK. Cytotoxic effect of methanolic extract of Morenga oleifera leaves on two cancer cell lines in vitro. Bioscience researches. 2019; 16(2): 1214-1222.

21. DoAmaral SCD, Santos AV, Schneider MP, daSilva HKR, Xavier LP. Determination of Volatile Organic Compounds and Antibacterial Activity of the Amazonian Cyanobacterium Synechococcus sp. Strain GFB01. Molecules. 2020; 25: 4744. doi:10.3390/molecules25204744

22. Sdiq KH, Salih SI, Kakayi ST. Evaluation of. Spirulina Platensis Crude Extract against some Pathogenic Microorganisms and Determination of Amino Acid Profile by HPLC, Erbil City. JUBPAS.2020; 28(1): 25-34.

23. Falaise C, François C, Travers MA, Morga B, Haure J, Tremblay B, et al. Antimicrobial Compounds from Eukaryotic Microalgae against Human Pathogens and Diseases in Aquaculture. Marine Drugs. 2016; 14(9): 159. doi: 10.3390/md14090159.

24. Mia ML, Habib MAB, Hoque N, Islam MS. A study on growth performance of Spirulina platensis in different concentrations of rotten apple as a carbon source. International Journal of Excellence Innovation and Development. 2019; 2(1): 29-40.

25. Wen-zang Q, Gen-li L, Cai-ye W. Techniques for extraction and isolation of natural products: a comprehensive review. Chinese Medicine. 2018; 3: 13: 20.

26. Shannon E, Abu-Ghannam N. Antibacterial Derivatives of Marine Algae: An Overview of Pharmacological Mechanisms and Applications. Marine Drugs. 2016; 14(4): 81. doi:10.3390/md14040081.

27. Fayyad RJ, Dwaish AS. Examination the growth of blue green alga, Chroococcus turigidus in different traditional media formulations. Journal of College of Basic Education. 2016; 22(95): 51-60.

28. Nalawade TM, Bhat K, Sogi SH. Bactericidal activity of propylene glycol glycerine, polyethylene glycol 400, and polyethylene glycol 1000 against selected microorganisms. Journal of International Society of Preventive and Community. 2015; 5(2):114-119. DOI: 10.4103/2231-0762.155736.

29. Ismail H, Bushra M, Ihsan-ul H, Muhammad S, Akhter Z, Basharat A. Synthesis, Characterization, and Pharmacological Evaluation of Selected Aromatic Amines. Journal of Chemistry. 2015: 1-9. https://doi.org/10.1155/2015/465286.

30. Xiong J, Li S, Wang W, Hong Y, Tang K, Luo Q. Screening and Identification of the Antibacterial Bioactive Compounds from Lonicera japonica Thunb. Leaves. Food Chemistry. 2013; 138(1): 327-333. doi: 10.1016/j.foodchem.2012.10.127.

31. Chandrasekaran M, Senthilkumar A, Venkatesalu V. Antibacterial and Antifungal Efficacy of fatty acid methyl esters from the leaves of Sesuvium portulacastrum L. European Review for Medical and Pharmacological Sciences. 2011; 15(7): 775-780.

32. Fayyad RJ, Numan RS, Hamdn NT, Hameed RS, Maliki SAJ. Assessment of antagonistic effect of alcoholic extract from cyanophyta (Spirulina platensis) against several human and plant derived pathogenic fungi. Indian Journal of Forensic Medicine and Toxicology. 2020; 14(1): 703-709. DOI: https://doi.org/10.37506/ijfmt.v14i1.134

33. Mohan NT, Kishore B, Suma HP. Bactericidal activity of propylene glycol, glycerine, polyethylene glycol 400, and polyethylene glycol 1000 against selected microorganisms. Journal of International Society of Preventive and Community Dentistry. 2015; 5(2): 114-119. doi: 10.4103/2231-0762.155736.

34. Ogunlesi M, Okiei EO, Osibote AE. Analysis of the essential oil from the dried leaves of Euphorbia hirta (Euphorbiaceae), a potential medication for asthma. African Journal of Biotechnology. 2009; 8(24): 7042-7050.

35. Marimuthu K, Nagaraj N, Ravi D. GC-MS Analysis of Phytochemicals, Fatty acids and Antimicrobial Potency of Dry Christmas Lima Beans. International Journal of Pharmaceutical Sciences Review and Research. 2014; 27(2): 63-66.

36. Mashkoor HH, Hameed IH, Ibraheem OA. Antimicrobial Activity and Spectral Chemical Analysis of Methanolic Leaves Extract of Adiantum Capillus Veneris Using) GC-MS and FTIR Spectroscopy. International Journal of Pharmacognosy and Phytochemical Research. 2016; 8(3): 369-385.

37. Dwaish AS, Yousif DYM, Alwan AH, Lefta SN. Anti-Dermatophytes Activity of Macroalgal Extracts (Chara vulgaris) Isolated from Baghdad City-Iraq. Journal of Global Pharma Technology. 2018; 10(03): 759-766.

38. Derengowski LS, De-Souza CS, Shélida VB, Mello-De-Sousa TM, Kyaw CM, Silva-Pereira I. Antimicrobial effect of farnesol, a Candida albicans quorum sensing molecule, on Paracoccidioides brasiliensis growth and morphogenesis. Annals of Clinical Microbiology and Antimicrobial. 2009; 8(13): 2-9. doi: 10.1186/1476-0711-8-13.

39. Ghorab MM, Alsaid MS, El‑Gaby MSA, Elaasser MM, Nissan YM. Antimicrobial and anticancer activity of some novel fuorinated thiourea derivatives carrying sulfonamide moieties: synthesis, biological evaluation and molecular docking. Chemistry Central Journal. 2017; 11(1): 32. doi: 10.1186/s13065-017-0258-4.

40. Shagufta IA. An Important Class Of Organic Compounds With Diverse Biological Activities, International Journal of Pharmacy and Pharmaceutical Sciences. 2015; 7(2): 19-27.

41. Yoshino N, Sugaya S, Nakamura T, Yoh-hei Y, Kondo Y, Kawada K, et al. Synthesis and antimicrobial activity of quaternary ammonium silane coupling agents. Journal of Oleo Science. 2011; 60(8): 429-438. doi: 10.5650/jos.60.429.

42. Zilbermintz LK, Martchenko M. Repurposing FDA approved drugs against the human fungal pathogen, Candida albicans. Annals of Clinical Microbiology and Antimicrobial. 2015; 14: 32. doi: 10.1186/s12941-015-0090-4.

Received on 11.02.2021 Modified on 09.04.2021

Research J. Pharm. and Tech 2022; 15(1):399-404.

DOI: 10.52711/0974-360X.2022.00066