INTRODUCTION:

Brucellosis is a zoonotic disease with worldwide distribution. The disease is endemic in many nations throughout the Middle East, Central Asia, Mediterranean regions, and Latin America^[1]. The term brucellosis used for the animal and human infections caused by different species belonging to the genus Brucella. Brucella species differ in their host’s preference, physiological abilities and cell surface structural characteristics. Those affecting domestic livestock are B. melitensis (sheep and goats), B. abortus (cattle), B. suis (swine), and B. ovis (sheep).^[2-3]

Brucella melitensis is one of the major causes of abortions in sheep and goats. The disease is transmitted between animals and to humans by direct or indirect contact with contamination sources like aborted fetuses, vaginal fluids, embryonic membranes, urine, and milk or by consumption of unpasteurized milk and milk products ^[4]. Infected ewes and goats shedding Brucella after birth or abortion with vaginal discharge for 2-3 months in goat and three weeks in ewes. They also shed the pathogen for 1-6 months in milk and (1-3) months in the urine^[5].

Brucella melitensis infection is recognized as a significant public health challenge, with a major economic and financial burden in countries where the disease remains endemic^[6]. In Iraq, brucellosis is endemic since 1937^[7-8]. Both human and animal attacked simultaneously in all governorates by this microorganism^[7].

There is still no vaccine available for humans, while the vaccination programs of animals against brucellosis is used to control the disease^[9]. as well as an essential tool to achieve its eradication^[10]. The most important methods control in sheep and goat is vaccination with live (Rev.1) or killed (H38) vaccine, and there is no safe and active vaccine used in sheep and goats^[11]. In the late 1950s, Elberg developed a live attenuated vaccine, strain Rev.1. The vaccine did not protect the animals from infection, but it prevents abortion of the infected animals ^[12-13]. The Brucella melitensis Rev-1 vaccine is considered the best available vaccine against brucellosis, although it is not the ideal vaccine due to its adverse effects^[14]. Rev-1 can infect humans and it is excreted in milk when adult animals are vaccinated^[15].

MATERIAL AND METHODS:

Sampling:

1. Animal samples:

· Milk samples: 30 Sheep milk samples and 30 Goat milk samples were taken from animals given a positive result with rose Bengal test.

· Vaginal discharges samples: 12 Vaginal swabs from aborted ewes and 20 Vaginal swabs from aborted goats were taken in period didn't exceed 10 days after the abortion.

2. Human samples:

· 50 blood samples taken from patients with Malta fever.

Culture methods:

· Milk samples: 10ml of milk sample centrifuged at then the fatty layer and the deposit layer inoculated into tubes containing Trypton soya broth^[5].

· Vaginal discharges: taken by cotton swab with Trypton soya broth as transport media.

· Blood culture: 10ml of un-clotted blood from patients with Malta fever inoculated in a flask containing trypton soya agar and trypton soya broth as in Castaneda method^[16].

Sub Culture methods:

Milk samples and vaginal discharge samples were re-inoculated into Brucella Basel agar, (Biolive/Italy) with 5% of sterile horse blood (Brucella selective supplement, Himedia-India) and incubated aerobically and anaerobically for 5 days at 37°C. The plates examined in order to detect colonies suspected of Brucella (soft, pearly white colonies)

The cultured media were incubated for 45 days and examined for growth in each 3 days.

Identification methods:

Brucella diagnosed by Gram stain and modified Ziehl-Neelson stain and biochemical tests recommended by ^[17].

Polymerase chain reaction (PCR):

DNA extraction: One colony of isolated bacteria dissolved in 200μl distilled water in epindorff tube. The tubes put in water bath at 100^°C for 10 minutes, then cooled in ice. The tubes centrifuged at 12000rpm for 20 second at 4^°C. The supernatant (which contain the DNA) put in Epindorff tubes and stored at -20^°C.

Primers: two types of primers used, one for Brucella spp omp2 gene (F: TGGAGGTCAGAAATGAAC/ R: GAGTGCG AAACGAGCGC) and the other one for Brucella melitensis IS711 gene (F: ACGCAGTCAGACGTTGCCTAT / R: TCCAGCGCACCATCTTTCAGCCTC).

PCR Conditions: PCR reaction conditions was 94°C (4 min) for initial denaturation, 94°C (1min) for denaturation, 60°C (1 min) annealing, 72°C (1 min) extension, final extension was 72°C (10 min), mixture final volume was 25μL. each reaction seteded up for 30 cycle

PCR-Restriction Fragment Length Polymorphism (RFLP) (Genetic methods for differentiation Brucella melitensis Rev.1)

Restriction enzymes (PstI) were used according to the manufacturer's instructions (Boehringer GmbH, Mannheim, Germany). That briefly 7μl of PCR product (positive sample), 6μl free nuclease sterile water, 1.7μl enzyme buffers, 0.3μl restriction enzyme (10- 20 U), in micro tube. Then the mixture incubated in a water bath for 2 hours at 37°C.

The digested DNA was separated by electrophoresis on 2% agarose gels. DNA fragments were visualized by staining with ethidium bromide (1.5μg/ml).

Biochemical methods for differentiation of Brucella melitensis Rev1:

The Differentiation of Brucella melitensis Rev.1 done according to the method recommended by [16] which included:

· Growth in media contain Penicillin in ratio 5 I.U./ml of media.

· Growth in media contain Streptomycin in concentration 2.5/µg/ml of media.

· Growth in media contain Thionin in the ratio 1:500000.

· Growth in media contain basic fuchsin in the ratio 1:500000.

The isolate considered as Field strain when grown in media contain: Penicillin, Thionin and basic fuchsin, and consider as Rev1 strain when grown in media contain Streptomycin.

DNA sequences of Brucella melitensis Rev1:

DNA extraction: The extraction of DNA was applied according to^[18].

Gene detection: 16S universal gene was detected by using of two primers:

· 27f: 5' AGAGTTTGATCMTGGCTCAG 3'

· 1494R: 5' TACGGYTACCTTGTTACGACTT 3'

DNA sequences: performed in MACROGENE- Korea and the results were compared with NCBI and control positive by BlAST program.

RESULTS AND DISCUSION:

Brucella isolation from animal samples:

Out of 92 samples, Brucella isolated from 43 cases in rate of 46.7% as in table 1 and 2. Therefore, 53.3% of total serological positive cases were negative for Brucella culture. That’s due to some culture media additives (which is used) like Nalidixic acid and Bacitracin were inhibitory to the growth of some brucella isolates^[19]. Also rose Bengal test cannot differentiate if anti-brucella antibody come from present or previous infection or from vaccination. Moreover, a positive serological test may be due to cross reaction with other bacterial infection like Yersinia enterocolitica ^[16,20].

According to sample types, the results revealed that the usage of vaginal discharge is better than milk samples in isolation of the causative agent. Since, milk not always prosperous for Brucella isolation because of interruptive bacterial shedding and low bacterial numbers^[20].

The isolation rate of brucella from goat were more than from sheep. The same result found by other authors ^[22]. All goat breeds sensitive to brucella while not all sheep breed sensitive to brucella^[4]. Also brucella shedding continuous for 2-3 months in goat and for only 3 weeks in sheep^[5].

Table 1. isolation ratio of Brucella melitensis from animal samples

Samples	No.	Positive case	Ratio
Sheep milk samples	30	9	30%
Goat milk samples	30	17	56.6%
Ewes Vaginal discharges	12	4	33.3%
Goat Vaginal discharges	20	13	65%
Total	92	43	46.7%

The Result of Brucella isolation from human blood samples:

Out of 50 human blood samples, Brucella isolated from 11 samples in rate of 22%. figure (1) shows positive results of PCR test for brucella genus. From table 5, it is clear that more than 80% of brucella isolated from animals and human were belonging to Brucella melitensis species. This agreed with^[^{4,19,23,24,25]}. All Brucella melitensis isolates were able to grow aerobically and anaerobically, H₂S negative, and given positive results in PCR test with B. melitensis (IS711 gene) Figure 2.

Figure 1: Electrophoresis on 2 % agarose gel M: DNA marker, 1: control positive, 10: control negative, wells 2-9 positive samples band in size 282 bp. (Brucella genus)

Table 2: Rate of Brucella melitensis isolates from total Brucella isolates

Type of Samples	Number of Brucella isolates	Number of Brucella melitensis isolates	Ratio
Animal sample	43	38	88.3%
Human sample	11	9	81.8%
Total	54	47	87.0%

Figure 2: Electrophoresis on 2 % agarose gel M: DNA marker, 9: control positive, 10: control negative, wells 1-8 positive samples band in size 731 bp

Differentiation between Rev.1 and field strains of Brucella melitensis:

The field strains were able to grow on media containing penicillin and thionin and basic fuchsin, and were unable to grow on media containing streptomycin vice versa Rev.1 strain. According to this aspect Rev.1 strain isolate in rate of 21% from animal and 11.1% from human source.

Result of RFLP test:

According to RFLP test, 21% and 11.1% of animals and human Brucella melitensis isolates distinguished as Brucella melitensis Rev1 as in table (3).

Rev.1 vaccine strain digests revealed two visible bands: 282 bp. due to the lack of PstI site and another band 238-bp in size (Lane 1, 3 and 5). In comparison, the PstI digestion of B. melitensis field strain digests revealed a single band, 238-bp in size (lanes 2, 4, 6 and 7). Our results agree with that of^[26] and ^[27].

(pst1) enzyme restricted Brucella melitensis Rev.1strain into two band; 238bp and 44 bp as in figure (3)

Table 3. Rate of Brucella melitensis Rev.1from total Brucella melitensis isolates differentiated according to RFLP test.

*Brucella melitensis* isolates	No.	*Positive (Brucella melitensis* Rev.1)**
Animal isolates	38	8
Human isolates	9	1
Total	47	9

Figure 3: Electrophoresis on 2 % agarose gel and ethidium bromide staining, of brucella PCR protected after extraction by (pst1) lane M: DNA marker, lane 1,6,7, 9: field strain of B. melitensis, 4,5,8: B. melitensis Rev.1 strain (restricted in tow band 238bp and 44 bp unclear). lane 2,3 B. melitensis Rev.1 strain(restricted part, and leave other)

Rev.1 vaccine strain digests revealed two visible bands 282 bp. Due to the lack of PstI site and another band 238-bp in size (Lane 1,3 and 5). In comparison, the PstI digestion of B. melitensis field strain digests revealed a single band, 238-bp in size (lanes 2, 4, 6 and 7). Our results agree with that of ^[26]and ^[27].

DNA sequences of Brucella melitensis Rev1:

Amplification of 16S Universal gene:

Brucella melitensis Rev.1 strain gave band with bp size 1400 (figure 4)

Figure 4: Electrophoresis on 2 % agarose gel and ethidium bromide staining, showing the results of PCR for 16S Universal gene procedures. M: DNA marker, wells 1-8 positive samples band in size 1400 bp.

Sequencing analysis of 16S universal gene was done for five isolates (suspected to be Rev.1 according to biochemical and PCR-RELP test) and one control positive (B. melitensis Rev.1 strain used in Iraqi vaccination program). Obtained sequences were aligned and matched with B. melitensis Rev.1.

The BLAST NCBI analysis of deduced sequences of 16S universal gene of the five isolates revealed 99% similarity with B. melitensis Rev.1 strain used in Iraqi vaccination program as in figure 5, and table 4.

Figure 5: Sequencing sample of 16s gene.

Table 4: Description of Mutations in region of 16s gene by using primer for 1400 pb.

No. of sample	Type of substitution	Location	Nucleotide	Range of nucleotide	Sequence ID	Score	Expect	Identities	Source
1	Transition	1081990	G>A	1081221 to 1082258	ID: CP024716.1	1849	0.0	99%	Brucella melitensis
	Transition	1082133	G>A
	Transition	1082178	G>A
	Trinsvertion	1082224	G>T
	Transition	1082230	G>A
2	Transition	1081990	G>A	1081221 to 1082229	ID: CP024716.1	1806	0.0	99%	Brucella melitensis
	Transition	1082133	G>A
	Transition	1082178	G>A
3	Transition	1081990	G>A	1081221 to 1082265	ID: CP024716.1	1862	0.0	99%	Brucella melitensis
	Transition	1082133	G>A
	Transition	1082143	A>G
	Transition	1082178	G>A
	Transition	1082230	G>A
4	Trinsvertion	1081980	G>C	1081221 to 1082229	ID: CP024716.1	1797	0.0	99%	Brucella melitensis
	Transition	1081990	G>A
	Transition	1082133	G>A
	Transition	1082143	A>G
	Transition	1082178	G>A
5	Trinsvertion	1081980	G>C	1081213 to 1082177	ID: CP024716.1	1723	0.0	99%	Brucella melitensis
	Transition	1081990	G>A
	Transition	1082133	G>A
	Transition	1082143	A>G
6	Transition	1082133	G>A	1081221 to 1082224	ID: CP024716.1	1793	0.0	99%	Brucella melitensis
	Transition	1082143	A>G
	Transition	1082178	G>A
	Trinsvertion	1082205	C>G

CONCLUSIONS:

This is the first study in Iraq that confirmed the isolation of Rev.1 strain from human brucellosis case.

ACKNOWLEDGMENTS:

The authors would like to thank all people who provided their samples and approval for genetic analysis.

CONFLICT OF INTEREST:

There is no conflict of interested.

REFERENCES:

1. Addis M. Public health and economic importance of brucellosis: A review. Public Health. 2015; 5(7): 68-84.

2. Ko J and Splitter GA. Molecular host-pathogen interaction in brucellosis: current understanding and future approaches to vaccine development for mice and humans. Clinical Microbiology Reviews. 2003; 16(1): 65-78.‏

3. Moriyón I, Grilló MJ, Monreal D, González D, Marín C, López-Goñi I and Blasco JM. Rough vaccines in animal brucellosis: structural and genetic basis and present status. Veterinary Research. 2004; 35(1): 1-38.‏

4. Radostits OM, Gay C, Hinchcliff KW and Constable PD. A textbook of the diseases of cattle, sheep, goats, pigs and horses. Veterinary Medicine 10th edition Bailliere, Tindall, London, UK.2007.

5. Alton GG, Jones LM, Angurs RD and Verger JM. Techniques for the Brucellosis Laboratory. INRA. Paris, France.1988.

6. WHO and OIE, Brucella melitensis in Eurasia and the middle east. FAO technical meeting in collaboration with WHO and OIE Rome, May 2009.

7. Al Zahawi S. Confirmation of the Existence of Undulant Fever in Iraq. Bulletin de l'Office International d'Hygiene Publique.1938; 30:1559-62.‏

8. Karaawi S. brucellosis in Iraq. J. Bio. Innov. 2016; 5(2): 285-293.‏

9. Zinsstag J, Schelling E, Roth F, Bonfoh B, De Savigny D andTanner M. Human benefits of animal interventions for zoonosis control. Emerging Infectious Diseases. 2007; 13(4): 527.‏

10. Nicoletti P. Vaccination against Brucella. Advances in Biotechnological Processes. 1990; 13: 147-168.‏

11. Ashford DA, Di PietraJ, Lingappa J, Woods C, Noll H, Neville B and Perkins BA. Adverse events in humans associated with accidental exposure to the livestock brucellosis vaccine RB51. Vaccine. 2004; 22(25): 3435-3439.‏

12. Elberg SS and Faunce Jr K. Immunization against Brucella infection VI. Brucella melitensis: Immunity Conferred on Goats by a Nondependent Mutant from a Streptomycin-Dependent Mutant Strain of1. Journal of Bacteriology.1957; 73(2): 211.‏

13. Elberg SS and Meyer KF. Caprine immunization against brucellosis: A summary of experiments on the isolation, properties and behavior of a vaccine strain. Bulletin of the World Health Organization. 1958;19(4): 711.‏

14. Bardenstein S, Mandelboim M, Ficht TA, Baum M and Banai M. Identification of the Brucella melitensis vaccine strain Rev. 1 in animals and humans in Israel by PCR analysis of the PstI site polymorphism of its Omp2 gene. Journal of Clinical Microbiology.2002; 40(4): 1475-1480.‏

15. Blasco JM. A review of the use of B. melitensis Rev 1 vaccine in adult sheep and goats. Preventive Veterinary Medicine.1997; 31(3-4): 275-283.‏

16. Alton GG, Jones LM and Pietz DE. Laboratory Techniques in Brucellosis. 2^nd ed. World Health Organization. Geneva. 1975.

17. Quinn PJ, Markey BK, Carter ME, Donnelly WJC and Leonard F C. Veterinary Microbiology and Microbial Disease. 1st ed. Blackwell Science Ltd; London. 2002.

18. Romero C, Pardo M, Grillo M, Diaz R, Blasco J, Lopez-Goni I (1995) Evaluation of PCR and indirect enzyme linked immunosorbent assay on milk samples for diagnosis of brucellosis in dairy cattle. J. Clin. Microbiol; 33: 3198-3200.

19. Marin CM, Alabart JL and Blasco JM. Effect of antibiotics contained in two brucella selective media on growth of Brucella abortus, B. melitensis and B. ovis. J. Clin. Microbiol. 1996; 34: 426-428.

20. Pouillot R, Garin-Bastuji B, Gerbier G, Coche Y, Can C, Dufour B and Moutou F. The brucellin skin test as a tool to differentiate false positive serological reactions in bovine brucellosis. Vet. Res.1997; 28: 365-374.

21. Corbe MJ and MacMillan A. Bovine brucellosis. In “Manual of standards for diagnostic tests and vaccines”. Office International des Epizooties. Paris. 2000.

22. Hamdy MER, Amin AS. Detection of Brucella species in the milk of infection cattle, sheep, goat and camels by PCR. Vet. J2002; 163:168-174.

23. OIE. caprine and ovine brucellosis. In: OIE manual of diagnostic tests and vaccines for terrestrial animals. 5th ed. 2004.

24. Blasco JM. A review of the use of B. melitensis Rev.1 vaccine in adult sheep and goats. Prev. Vet. Med1997; 31:275-283.

25. Hadad JJ and Al-azawy Z S. Incidence of brucellosis in sheep and goats in Ninevah Province. Iraqi J. Vet. Sci1990; 4(1): 27-33.

26. Mullis KB and Faloona FA. Specific synthesis of DNA in vitro via a polymerase-catalyzed chain reaction. In Methods in Enzymology (Vol. 155, pp. 335-350). Academic Press.‏ 1987.

27. Nashwa MH, Hoda MZ and Adawy SS. Identification and Differentiation of Brucella melitensis Rev.1 Vaccine and B. Melitensis Biovar 3 Field Isolates in Egypt by Serological and PCR-RELP Techniques. Journal of Applied Sciences Research. 2007; 3(9): 841-847.

Received on 13.07.2019 Modified on 25.09.2019

Research J. Pharm. and Tech. 2020; 13(12):5866-5870.

DOI: 10.5958/0974-360X.2020.01022.7