Superantigenic Toxin Genes in Some Methicillin Resistant Coagulase Negative Staphylococci
Sana’a Noori Hussein1, Qasim Obaid Bdaiwi2, Ibtesam Ghadban Auda3, Amal Aziz Kareem4
1,3Department of Biology, Collage of Science, Mustansiriyah University, Iraq
2Directorate of Education in Babylon, Ministry of Education, Iraq
4Faculty of Health and Medical Sciences, Medical Technical University, Baghdad - Iraq.
*Corresponding Author E-mail: drnihadkhalawe@gmail.com, sanaa-kakie@uomustansiriyah.edu.iq, qasemaubeed72@gmail.com
ABSTRACT:
Coagulase-negative staphylococci (CNS) exemplify common skin commensals. They are opportunistic microorganisms. It has been recently confirmed that CNS can produce superantigens of Staphylococcus aureus. Different clinical samples (251) were collected from Al-Musayyib General Hospital in Babylon, Iraq. Sixty isolates were CNS, identified by conventional methods and Vitek2 system. The isolates were Staphylococcussciuri (31.66%), Staphylococcus haemolyticus (25%), Staphylococcussaprophyticus (23.33%) and Staphylococcus lentus (20%), the isolate obtained from seminal fluid, blood, tonsil and wound infections. All isolates showed resistant to methicillin antibiotic. Multiplex PCR was used to detect the presence of mecA, sea, seb, seg, seh, sei, selpand tst1 in Methicillin resistant CNS. This study suggested that MRCNS isolates from patient carried sea, seb, seg, seh, sei, and tst1superantigenic toxin genes.
KEYWORDS: CNS.mecA. S. haemolyticus, S. lentus. S. saprophyticus. S. sciuri. Superantigen.
INTRODUCTION:
Staphylococci are Gram-positive microorganisms belongs to the family Staphylococcaceae, order Bacillales, class Bacilli in the phylum Firmicutes. Thirty-eight species and thirteen subspecies of coagulase negative Staphylococci CNS have been accurately described [1]. Amongst these, the species group that includes oxidase-positive (i.e. Staphylococcus sciuriand Staphylococcus lentus) are deliberated of excessive interest, together phylogenetically and clinically, because of these strains are mostly signifies with environmental and wild animal origins that have not been submitted to selective pressures due to human influence.
Coagulase-negative staphylococci (CNS) mainly cause nosocomial infections, such as catheter-related bloodstream infections, prosthetic valve endocarditis, central nervous system shunt infections and prosthetic joint infection [2]. The omnipresent dissemination of S. sciuri surely makes this species the most famous group illustrative of the oxidase positive staphylococci [3]. Staphylococcus haemolyticusis a member of CNS that constitute most of the typical human skin vegetation. Be that as it may, worries over S. haemolyticus as a developing human pathogen are expanding, as it is currently the second most much of the time secluded life form from blood diseases among CNS after S. epidermidis [4,5]. However, the taxonomic validity of such delineation in the absence of genome analysis is currently subjected to controversial debates [6]. CNS have truly being portrayed as kindhearted commensal creatures [7,8]. Today, CNS speak to one of the major nosocomial pathogens in human and animal medicine [9]. Staphylococcal Cassette Chromosome (SCC) mec is easily transmitted to CNS, CNS play an important role in spreading and horizontal transfer of drug resistance gene [10,11].
Staphylococcal superantigens (SAgs) including staphylococcal enterotoxins (SEs) and toxic shock syndrome toxin-1 (TST1) [12]. have been classified as member of the pyrogenic superantigen toxins family for the reason that of their biological actions and structural relatedness [13]. This study aimed to determine the presence of superantigen toxin genes in some Methicillin resistant of clinical coagulase-negative staphylococci isolates.
MATERIALS AND METHODS:
Sample Collection:
A total of 251 samples of seminal fluid infections, septicemia, tonsillitis and wound infections were obtained from patients (12-45 years old), hospitalized at Al-Musayyib General Hospital in Babylon, Iraq for the period of September to December 2017. Conventional methods, standardized biochemical methods; catalase test, oxidase test, coagulase test, mannitol fermentation [14,15] and Vitek 2 system ( Biomerieux, USA) were used to identify the bacterial isolates.
Phenotypic Detection of Methicillin Sensitivity:
The isolates were experienced for cefoxitin (30μg) and cefepime (30μg) with the disc diffusion method according to the Clinical and Laboratory Standards Institute guidelines [16]. Zones of inhibition were measured and compared with the CLSI guideline.
DNA Extraction:
Genomic DNA was extracted by using Geneaid GBB100, Taiwan kit. Extraction of DNA was done according to manufacturer's instructions. Nanodrop framework Promega (USA) was utilized to assess DNA concentration and purity. DNA was stored at -20 ºC for PCR assay.
Primers Selection:
The sequence of oligonucleotide forward and reverse primers( Alpha DNA, Canada) which were used to detect sea, seb, seg, seh, sei, selp, tst1 and mecA are listed in the table 1. The volumes of primers were between 1.1 to 2.3 µl which were added to reaction mix with a final concentration 0.2 µM of each primer.
Table ( 1):List of the primers
|
Genes |
Primers |
Oligonucleotides sequence 5′ ……..……….. 3′ |
PCR products (bp) |
References |
|
sea |
SEA-3 |
CCTTTGGAAACGGTTAAAACG |
127 |
17 |
|
|
SEA-4 |
TCTGAACCTTCCCATCAAAAAC |
|
|
|
seb |
SEB-1 |
TCGCATCAAACTGACAAACG |
477 |
17 |
|
|
SEB-4 |
GCAGGTACTCTATAAGTGCCTGC |
|
|
|
seg |
SEG-1 |
AAGTAGACATTTTTGGCGTTCC |
287 |
18 |
|
|
SEG-2 |
AGAACCATCAAACTCGTATAGC |
|
|
|
seh |
SEH-1 |
GTCTATATGGAGGTACAACACT |
213 |
19 |
|
|
SEH-2 |
GACCTTTACTTATTTCGCTGTC |
|
|
|
sei |
SEI-1 |
GGTGATATTGGTGTAGGTAAC |
454 |
18 |
|
|
SEI-2 |
ATCCATATTCTTTGCCTTTACCAG |
|
|
|
selp |
SEP-3 |
TGATTTATTAGTAGACCTTGG |
396 |
18 |
|
|
SEP-4 |
ATAACCAACCGAATCACCAG |
|
|
|
tst1 |
TST-3 |
AAGCCCTTTGTTGCTTGCG |
447 |
17 |
|
|
TST-6 |
ATCGAACTTTGGCCCATACTTT |
|
|
|
mecA |
GMECAR-1 |
ACTGCTATCCACCCTCAAAC |
163 |
20 |
|
|
GMECAR-2 |
CTGGTGAAGTTGTAATCTGG |
|
Multiplex PCR:
Multiplex PCR of each basis set was performed with GoTaq Green Master Mix PCR Kit as demonstrated by producer's rules. Each reaction, blend 50μl involved 25 μl of 2X PCR Master Mix, 2μl of each primer and 2μl (10– 100 ng) of DNA template and 7μl of nucleus free water. DNA enhancement was finished with the going with warm cycling: an underlying denaturation of DNA at 95°C for 15 min was trailed through 35 cycles of intensification (95°C for 30s, 57°C for 1.5 min, and 72°C for 1.5 min), completing through a last augmentation at 72°C for 10 min. The products of PCR were settled by electrophoresis in 2% agarose gel in 1X TBE buffer for 60 min. colored by 5μl/100ml of Red Safe and imagined on a transilluminator [21].
RESULTS AND DISCUSSION:
Isolation and Identification:
Out of 251 clinical samples only 60 isolates were CNS, distributed as following: S. sciuri 19 (31.66%) isolates, S. haemolyticus 15(25%) isolates, S. saprophyticus 14 (23.33%) isolates and S. lentus 12 (20%) isolates depending on colony morphology, biochemical tests and Vitek2 system as shown in figure (1). Svecet al. (2016) collected a group of S. sciuri (n=62) isolates obtained from human, while Kawamura et al. [22] found that S. haemolyticus (12.2%) and S. saprophyticus (3.6%).
S. sciuri was the most common isolate (31.66%) while S. haemolyticus was the second most common isolate (25%). A total of 178 (70.91%) samples from males while 73 (29.08 %) from female patients. Sangwan and Kumari [23] reported that the most common isolate in India was S. epidermidis (38.33%) while S. saprophyticus (35%) was the second recorded common isolated afterward S. haemolyticus (15%). The identification of CNS species and the characterization of the genetic diversity of the strains constitute a first step towards CNS safety assessment [24].
Screening for Methicillin-Resistant Isolates:
A-Phenotypic method:
Disc diffusion method was used to detect methicillin resistanct isolates , two types of antibiotics were used; cefoxitine and cefepime antibiotic discs [25]. All isolates showed resistance to cefoxitin and cefepime. The emergence of CNS not only as human pathogens but also as reservoirs of antibiotic resistance determinants requires the deployment and development of methods for their rapid and reliable identification [26].
B-Genotypic method:
Additional way to detect methicillin resistanct isolates was done depending on a mobile genetic element mecA, multiplex PCR assay was intended for direct detection of methicillin resistance gene mecA [21, 27-28]. Based on the specific amplifications of the mecA gene, the multiplex PCR procedure permitted the specific identification of isolates and the determination of its susceptibility to β-lactam antibiotics. The results showed that 25% of isolates contained mecA gene figure (2). While Krediet et al. [29] established that 92% of all CNS isolates were mecA positive.
The mecA gene is the essential gene located in the chromosome that encodes the modified penicillin binding protein PBP2, which has a lower affinity for beta-lactams due to a distorted active site [30]. A study by Ghaznavi-Rad et al. [31] in Iran was found high level of SCCmec genetic variety amongst MRCoNS isolates and all of the (70 MR-CoNS) isolates were contained mecA gene. isolates under study were defined as Methicillin Resistant if resistant by cefoxitin and cefepime or if mecA positive [32].
Figure 2: Gel electrophoresis (2% agarose,7v/cm2 for 60 min) for PCR products genes, lanes M 100 bp DNA Ladder, lanes 2,12,16 represents mecA band 163bp, lane 6 representsmecA plus tst1 band 447bp, lane 7 represents sei band 454bp plus seg band 287bp, lane 13 represents seh band 213bp, lane 17 represents mecAplusseh, lane 24 represents mecA plus seb band 477bp and lane 25 representsmecA plus sea band 127bp.
Distribution of Superantigenic Toxin Genes among the Isolates:
Genes amplification by multiplex PCR technique was used for detection of sea, seb, seg, seh, sei, selp and tst1 genes. Results showed that only S. sciuricarry sea, seb genes, S. lentuscarry seh gene, S. saprophyticuscarry seg, sei, tst1 genes, S. haemolyticus avoid any of these genes as shown in figure (2). Orden et al. [33] also found three CNS strains produce tst1, SEs and tsst1 are exotoxins originally identified in S. aureus, but they are also detected in CoNS [34].
All isolates were devoid from selpgene, S. sciuri, S. haemolyticus, S. saprophyticus and S. lentusare a reservoir of genes that, after horizontal transfer, facilitate the potential of S. aureus to colonize, survive during infection, or/and resist antibiotic treatment, Otto [35] have provided additional examples supporting the hypothesis that S. epidermidis and other CoNS have an important function as providers of genes that contribute to the survival of S. aureus during infection and as a commensal.
The enterotoxins that generated by the sea gene generate more severe immunological responses and subsequently more tissue damages compared with other enterotoxins. However, SEs are similar in structural characteristics and biological activities, but they are different in their mechanisms of actions [36]. The enterotoxin genes are encoded in mobile genetic elements, such as prophages, plasmids, and pathogenic islands. Those mobile genetic elements are responsible for the horizontal transfer of virulence or antibiotic resistance genes. Staphylococcal toxins are designated as SE with demonstrated emetic activity, while staphylococcal-like toxins showed no emetic activity in primate models [37,38].
Table (2): Prevalence of superantegenic toxin genes and mecA gene among the isolates
|
Genes |
Number of Isolates |
|||
|
S. sciuri |
S. haemolyticus |
S. saprophyticus |
S. lentus |
|
|
sea |
10 (16.66%) |
0 |
0 |
0 |
|
seb |
4 (6.66%) |
0 |
0 |
0 |
|
seg |
0 |
0 |
4(6.66%) |
0 |
|
seh |
0 |
0 |
0 |
5 (8.33%) |
|
sei |
0 |
0 |
6(10%) |
0 |
|
selp |
0 |
0 |
0 |
0 |
|
tst1 |
0 |
0 |
5(8.33%) |
0 |
|
mecA |
19 (31.66%) |
15(25%) |
14(23.33%) |
20 (33.33%) |
ACKNOWLEDGEMENTS:
The authors would like to thank Mustansiriyah University (www.uomustansiriyah.edu.iq) Baghdad- Iraq for its support in the present work.
REFERENCES:
1. Heß S, Gallert C. Staphylococcus argensis sp. nov., a novel staphylococcal species isolated from an aquatic environment. International Journal of Systematic and Evolutionary Microbiology. 2015; 65(8): 2661-2665.
2. Hirotaki S, Sasaki T, Kuwahara-Arai K, Hiramatsu K. Rapid and accurate identification of human associated staphylococci by multiplex PCR. Journal of Clinical Microbiology JCM. 2011; 00488.
3. Nemeghaire S, Argudin MA, Fessler AT, Hauschild T, Schwarz S, Butaye P. The ecological importance of the Staphylococcus sciurispecies group as a reservoir for resistance and virulence genes. Vet. Microbiol. 2014; 171: 342-356.
4. Silva PV, Cruz R.S, Keim LS, Paula GR, Carvalho BT, Coelho LR. The antimicrobial susceptibility, biofilm formation and genotypic profiles of Staphylococcus haemolyticus from blood stream infections. Mem Inst Oswaldo Cruz. 2013; 108(6): 812-813.
5. Czekaj T, Ciszewski M, Szewczyk EM. Staphylococcus haemolyticus- an emerging threat in the twilight of the antibiotics age. Microbiology. 2015; 161(11): 2061-2068.
6. Švec P, Petráš P, Pantůček R, Doškař J, Sedláček I. High intraspecies heterogeneity within Staphylococcus sciuri and rejection of its classification into S. sciuri subsp. sciuri, S. sciuri subsp. carnaticus and S. sciuri subsp. rodentium. Int. J. Syst. Evol Microbiol. 2016; 66: 5181-5186.
7. Pulverer G, Pillich J. Pathogenic significance of coagulase-negative staphylococci. In Bacterial Infections. Springer, Berlin, Heidelberg.1971; pp. 91,97.
8. Bascomb S, Manafi M. Use of enzyme tests in characterization and identification of aerobic and facultatively anaerobic Gram-positive cocci. Clin. Microbiol. 1998;11: 318-340.
9. Piessens V, Van Coillie E, Verbist B, Supre K, Braem G, Van Nuffel A, De Vuyst L, Heyndrickx M, De Vliegher S. "Distribution of coagulase-negative Staphylococcus species from milk and environment of dairy cows differs between herds." Journal of Dairy Science. 2011; 94: 2933-2944.
10. Yang TY, Hung W, Lin L., Hung W, Tseng S. mecA-related structure in methicillin-resistant coagulase negative staphylococci from street food in Taiwan.Scientific Reports. 2017; 7:42205.
11. Madsena AM, Moslehi-Jenabiana S, Islamb MZ, Frankela M, Spilakc M, Frederiksena MW. Concentrations of Staphylococcus species in indoor air as associated with other bacteria, season, relative humidity, air change rate, and Staphylococcus aureus positive occupants.Environmental Research. 2018; 160:282–291.
12. Park JY, Fox Lk, Seo KS, Mc Guire, MA, Park yH, Rurangirwa FR, Sischo WM, Bohachg A. Detection of classical and newly described staphylococcal superantigen genes in coagulase-negative staphylococci isolated from bovine intramammary infections. Veterinary Microbiology. 2011; 147: 149–154.
13. Proft T, Fraser JD. Bacterial superantigens. Clin Exp Immunol. 2003; 133(3): 299-306.
14. Stepanovic S, Dakic I, Morrison D, Hauschild T, Jezˇek P, Petr Petra´s P, Marte A, Dragana Vukovic D, Shittu A, Luc A, Devriese SA. Identification and Characterization of Clinical Isolates of Members of the Staphylococcus sciuri Group. Journal of Clinical Microbiology. 2005; 956–958.
15. Winn WC, Allen S D, Janda W M, Koneman EW. Koneman's Color Atlas and Textbook of Diagnostic Microbiology. 2006; 6:649-650.
16. Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Susceptibility Testing, M100-S23, M02-A11 and M07-A9. CLSI ,Wayne, PA.2013.
17. Becker K, Roth R, Peters G. Rapid and specific detection of toxigenic Staphylococcus aureus: use of two multiplex PCR enzyme immunoassays for amplification and hybridization of staphylococcal enterotoxin genes, exfoliative toxin genes, and toxic shock syndrome toxin 1 gene. Journal of Clinical Microbiology. 1998; 36(9): 2548-2553.
18. Omoe K, Hu D L, Takahashi-Omoe H, Nakane A, Shinagawa K. Comprehensive analysis of classical and newly described staphylococcal superantigenic toxin genes in Staphylococcus aureus isolates. FEMS microbiology letters. 2005; 246(2): 191-198.
19. Omoe K, Ishikawa M, Shimoda Y, Hu D L, Ueda S, Shinagawa K. Detection of seg, seh, and sei genes in Staphylococcus aureus isolates and determination of the enterotoxin productivities of S. aureus isolates harboringseg, seh, or sei genes. Journal of clinical microbiology. 2002;40(3): 857-862.
20. Mehrotra M, Wang G, Johnson W M. Multiplex PCR for detection of genes for Staphylococcus aureus enterotoxins, exfoliative toxins, toxic shock syndrome toxin 1, and methicillin resistance. Journal of Clinical Microbiology. 2000; 38(3): 1032-1035.
21. Bdaiwi QO, Hussein SN. Comparison of superantigenic toxins genes between MRSA and MSSA isolated from clinical specimens in Iraq. Pak. J. Biotechnol. 2017;14(4): 689-695.
22. Kawamura Y, Hou XG, Sultana F, Hirose K, Miyake M, Shu SE, Ezaki T. Distribution of Staphylococcus Species among Human Clinical Specimens and Emended Description of Staphylococcuscaprae. Journal of Clinical Microbiology. 1998; 36(7): 2038-2042.
23. Sangwan J, Kumari S. Isolation, Identification and Antibiogram of Coagulase Negative Staphylococcus (CoNS) Isolated from Various Clinical Samples at a Tertiary Care Teaching Hospital, Jaipur, India. Int. J. Curr. Microbiol. App. Sci. 2018; 7(1): 3048-3059.
24. Coton E, Desmonts MH, Leroy S, Coton M, Jamet E, Christieans S, Talon R. Biodiversity of coagulase-negative staphylococci in French cheeses, dry fermented sausages, processing environments and clinical samples. International Journal of Food Microbiology. 2010; 137(2-3): 221-229.
25. Mendes RE, Watters AA, Rhomberg PR, Farrell DJ, Jones, RN. Performance of BD Max Staph SR for Screening of Methicillin- Resistant Staphylococcus aureus Isolates among a Contemporary and Diverse Collection from 146 Institutions Located in Nine U.S. Census Regions: Prevalence of mecA Dropout Mutants. Journal of Clinical Microbiology. 2016; 54(1):204-207.
26. Couto I, Pereira S, Miragaia M, Sanches IS, de Lencastre H. Identification of clinical staphylococcal isolates from humans by internal transcribed spacer PCR. Journal of Clinical Microbiology. 2001;39(9): 3099-3103.
27. Shittu A, Lin J, Morrison D, Kolawole D. Isolation and molecular characterization of multiresistant Staphylococcus sciuri and Staphylococcus haemolyticus associated with skin and soft-tissue infections.Journal of Medical Microbiology. 2004; 53: 51–55.
28. Jubair HH, Khlebos AH. Molecular Detection of Methicillin and Vancomycin Resistance in Staphylococcus aureus Isolated From Burn and Wound Infection Patients. Al-Kufa University Journal for Biology. 201; .46-50.
29. Krediet TG, Jones ME, Gerards L J, Fleer A. Clinical outcome of cephalothin versus vancomycin therapy in the treatment of coagulase-negative staphylococcal septicemia in neonates: relation to methicillin resistance and mecA gene carriage of blood isolates. Pediatrics. 1999;103(3): 29.
30. Deurenberg RH, Stobberingh EE. The evolution of Staphylococcus aureus. Infect Genet Evol. 2008; 8: 747-763.
31. Ghaznavi-Rad E, Fard-Mousavi N, Shahsavari A, Japoni-Nejad A, Van Belkum A. Distribution of staphylococcal cassette chromosome mec types among methicillin-resistant coagulase negative staphylococci in central Iran. Iranian Journal of Microbiology. 2018;10(1): 7-13.
32. Mottola C, Semedo-Lemsaddek T, Mendes J J, Melo-Cristino J, Tavares L, Cavaco-Silva P, Oliveira M. Molecular typing, virulence traits and antimicrobial resistance of diabetic foot staphylococci. Journal of biomedical science. 2016; 23(1): 33.
33. Ordenj A, cid D, blanco ME, quiteria JAR, gomez-lucia E, de la fuente R. Enterotoxin and toxic shock syndrome toxin-one production by staphylococci is elated from mastitis in sheep. APMIS.1992; 100: 132-134.
34. Fijałkowski K, Struk M, Karakulska J, Paszkowska A, Giedrys-Kalemba S, Masiuk H, ... & Nawrotek, P. Comparative analysis of superantigen genes in Staphylococcus xylosus and Staphylococcus aureus isolates collected from a single mammary quarter of cows with mastitis. Journal of Microbiology.2014; 52(5): 366-372.
35. Otto M. Coagulase‐negative staphylococci as reservoirs of genes facilitating MRSA infection. Bioessays. 2013; 35(1): 4-11.
36. Ferry T, Thomas D, Genestier AL, Bes M, Lina G, Vandenesch F. Comparative prevalence of superantigen genes in Staphylococcus aureus isolates causing sepsis with and without septic shock. Clin Infect Dis.2005; 41(6): 771–777.
37. Nunes RSC, de Souza CP, Pereira KS, Del Aguila EM, Paschoalin VMF. Identification and molecular phylogeny of coagulase-negative staphylococci isolates from Minas Frescal cheese in southeastern Brazil: Superantigenic toxin production and antibiotic resistance. Journal of Dairy Science. 2016; 99(4): 2641-2653.
38. Essa RA, Hussain SS, Tektook NK. Relationship between Ica gene and hemaaglutination in Staphylococcus epidermidis form biofilm.", J. of Genet. Environ. Resour. Conserv.2015; 3(1): 74-83.
Received on 11.02.2019 Modified on 02.03.2019
Accepted on 02.04.2019 © RJPT All right reserved
Research J. Pharm. and Tech 2019; 12(9):4480-4484.
DOI: 10.5958/0974-360X.2019.00771.6