Decaffeinated green tea extract regulates glucose metabolism in insulin-sensitive cell lines

 

Sattar J. J. AL-Shaeli*, Ali M. Ethaeb

Department of Histology, College of Veterinary Medicine, University of Wasit, AL-Hay, Wasit, Iraq.

 

ABSTRACT:

Impairment of glucose and lipid metabolism are markers of insulin resistance, obesity, and type 2 diabetes (T2D). Green tea showed numerous potential biological activities and health benefits including amelioration this impairment, however, the underpinning mechanism is not yet fully understood. Therefore, the effect of green tea extract on glucose uptake and utilisation in 3T3-L1 (adipocyte), AML12 (hepatocyte), and C2C12 (myocyte), and the possible mechanism of this effect were investigated. 2-NBDG uptake in the presence of adenosine 5’-monophosphate-activated protein kinase (AMPK) and protein kinase B (Akt) inhibitors, hepatic glycogen, adipocytes triglyceride, and glycerol released, cell viability, and metabolic gene expression were assessed. Green tea upregulated expression of glucose transporter 4 and 2 (GLUT4, 2) and therefore increased glucose uptake in all cell lines. This effect was suppressed in adipocytes and hepatocytes by Akt inhibitor, while AMPK inhibitor suppressed glucose uptake in myocytes. Furthermore, Green tea activated glycogen synthase (GyS1) gene and increased hepatic glycogen formation accordingly, alongside reduced gluconeogenesis activity gene glucose 6 phosphatase (G6Pase) and phosphoenolpyruvate carboxykinase (PEPCK). A remarkable reduction in cellular triglyceride and glycerol released from 3T3-L1 were observed, suggesting suppressed adipogenesis and lipolysis. This inhibitory effect attributed to downregulation of CCAAT-enhancer-binding protein alpha (C/EBPα), sterol regulatory element binding protein 1c (SREPB1c), fatty acid synthase (FASN), fatty acid binding protein 4 (FABP4), and lipoprotein lipase (LPL) gene expressions. Finally, green tea could regulate glucose and lipid metabolism through activating phosphoinositide 3-kinase (PI3K)/Akt and AMPK and their downstream signalling, and therefore could be a potential anti-obesity and anti-diabetic agent.

 

 

 

1. INTRODUCTION:

Food consumption and glycogenolysis are the primary sources of glucose that required for cellular energy, and thus its circulatory level depends on glucose entering and being transported to the cells and tissues¹. Therefore, regulating normal blood glucose level is essential mechanism called glucose homeostasis which depends on the role of insulin and glucagon to regulate glucose metabolism in essential metabolic tissues including liver, skeletal muscles, and adipose tissue².

 

Impairment of this mechanism could occur either due to the inability of pancreatic beta cells to produce sufficient insulin associated with or without lost insulin sensitivity^3,4,5,6, and then type 2 diabetes mellitus is diagnosed, which is a major metabolic disorder and global health issue.

 

Green tea is a favoritedrink and considered the second most consumption globally next to black tea^{7, 8}.The increasing consumption of green tea is referred to several health promotion properties that assigned to active ingredients that preserved in it^9,10,11. Abundant catechins are new compounds thought to be responsible for the most healthy effect of regular drinking of green tea¹². The catechins composed of several active ingredients including 6% catechin, 11% epicatechin, 14% epicatechingallate, 23% epigallocatechin, and 41% epigallocatechin gallate, in addition to less potent quercetin, myricetin, and kaempferol¹³.

Several potential health promotions have been linked to consumption of green tea and its catechins^14,15. One of these benefits is the regulation of glucose metabolism and amelioration of the most markers of diabetes, therefore suggesting to have anti-diabetes properties^16,17,18. Despite this possible health benefit, the precise mechanisms of this impact are poorly understood and require further studies to elucidate. The present study, therefore, attempts to investigate the effects of crude extract of green tea to regulate glucose metabolism in the insulin sensitive cell models through measuring some markers regarding cellular glucose metabolism.

 

2. MATERIALS AND METHODS:

2.1 Cell lines culture and differentiation:

Mouse myoblast (C2C12) and hepatocytes (AML12) mouse hepatocytes were obtained from American Type Culture Collection (ATCC® CRL1772™ and CRL2254™), while mouse embryonic fibroblast (3T3-L1) was purchased from ZenbioInc., Cambridge Bioscience, Uk (Zenbio® SP-L1-F). All other materials and reagents that have been used in this research were purchased from Sigma Aldrich and Life Technologies, UK unless otherwise stated. AML12 cells were cultured in Dulbecco's modified Eagle's medium (DMEM) and Ham's F12 supplemented with 0.005 mg/ml insulin and transferrin, five ng/ml selenium, and 40 ng/ml dexamethasone. Both C2C12 and 3T3L1 cells were proliferated in a high glucose DMEM, and the differentiation was induced according to¹⁹ protocol before the treatment. The cells were routinely maintaine data 37ᵒC temperature and 5% CO₂ in humidified air atmosphere.

 

2.2 2-NBDG uptake monitoring assay:

A 10000/ well of AML12, differentiated 3T3-L1 and C2C12 were cultured into 96 wellplates and were serum starved in low glucose medium for 2h. Cells were subsequently incubated in DMEM low glucose containing commercial certified green tea extract (Blackburn distributions, UK) at 50, 100, 150 mg with 100µM of 2-NBDG for 6h. The cellular 2-NBDG uptake was then measured according to manufacturer protocol. The assay was reapated by exposing the cells to 100 mg of green tea extract without and with 10µM of Dorsomorphin dihydrochloride (AMPK inhibitor) and 10-[4'-(N,N-Diethylamino)butyl]-2-chlorophenoxazine hydrochloride (Akt inhibitor) separately for 12h.

 

2.3 Glycogen content analysis in hepatocytes:

Cultured cells were serum starved for 2h and subsequently treated with various concentration of green tea extract for 24 and 48h. The harvested cells were then homogenized, and the glycogen concentration was determined by EnzyChrom™ Glycogen Assay Kit (Bio Assay Systems, Cat#E2GN-100) following manufacturer procedure.

2.4 Triglyceride content analysis in adipocytes:

Differentiated cells were incubated in serum-free medium for 2h, then exposed to various concentration of green tea in addition to 200nM insulin and 10µM isoprenaline for 24 and 48h. Cells were washed with PBS and triglycerides were extracted in 5% (v/v) of Triton (Fisher Scientific, UK). The triglyceride content was measured using EnzyChrom™Triglyceride Assay Kit (BioAssay Systems, UK, Cat#ETGA-200) following their protocol.

 

2.5 Measurement glycerol release from adipocytes:

Mature, cultured cells were serum starved for 2h and subsequently treated with green tea extract, as well as insulin and isoprenaline for 24 and 48h. Free glycerol released was estimated in the medium using the commercial free glycerol reagents kit (Sigma Aldrich, UK) based on provided protocol.

 

2.6 Adipocytes oil red o staining:

At the various time of differentiation, oil red o staining was performed. Briefly, cells were washed with PBS and fixed 30 minutes at 37ᵒC with 10% formaldehyde. Cells were then washed with dH₂O and incubated with 60% isopropanol for 5 minutes at room temperature. Cells were rinsed in oil red o working solution for 15 minutes at 37ᵒC and subsequently washed and examined under an inverted fluorescence microscope (Leica DMI4000 B inverted microscope).

 

2.7 Cell viability assay:

Cells were cultured at density 5x10³/ well of 96 well plate in stander conditions. Bothe 3T3-L1 and C2C12 were differentiated before treatment and assay. Various concentrations of green tea extract were supplemented for 24 and 48h, and cell viability was measured by using PrestoBlue™ reagent following the manufacturer procedure.

 

2.8 RNA extraction, cDNA syntheis, and Real-time Polymerase Chain Reaction (qPCR):

AML12, differentiated C2C12 and 3T3-L1 cells were incubation in serum free medium for 2h, and subsequently exposed to 100mg of green tea extract for 24h. The total RNA was extracted using Trizol® Reagent (Life Technologies, UK) according to their protocol. A 1µg of the total RNA was reverse transcribed by cDNA synthesis kit (Primer design, UK) using programmed thermocycler (Thermofisher Scientific, UK) following instruction provided. Specific mouse metabolic genes were amplificated using SYBR® Green qPCR and Stratagene MX3000P™ thermal cycler (Stratagene, UK) based on manufacturer procedure. All the primers were obtained from Thermofisher Scientific, UK, and their sequences are list below. The gene expression was calculated from cycle threshold (Ct) that obtained for both housekeeping and interesting genes using equation 2ˆ∆∆Ct²⁰.

3T3-L1:

mIR F/ AATGGCAACATCACACACTACC R/ CAGCCCTTTGAGACAATAATCC

mGLUT4 F/ ACATACCTGACAGGGCAAGG R/ CGCCCTTAGTTGGTCAGAAG

mLPL            F/ TGGATGAGCGACTCCTACTTCA R/ CGGATCCTCTCGATGACGAA

mFASN         F/ GGCTCTATGGATTACCCAAGC R/ CCAGTGTTCGTTCCTCGGA

mFABP4       F/ TCACCATCCGGTCAGAGAGTA R/ GCCATCTAGGGTTATGATGCTC

mCEBPα F/ TGGATAAGAACAGCAACGAG R/ TCACTGGTCAACTCCAACAC

mSREBP1c F/ CAACGCTGGCCGAGATCTAT R/ TCCCCATCCACGAAGAAACG

mPPARγF/GTCACGTTCTGACAGGACTGTGTGACR/ ATCACTGGAGATCTCCGCCAACAGC 

 

AML12:

mIR F/ AATGGCAACATCACACACTACC R/ CAGCCCTTTGAGACAATAATCC

mGLUT2  F/ TGTGCTGCTGGATAAATTCGCCTG R/ AACCATGAACCAAGGGATTGGACC

mG6Pase     F/ AACGCCTTCTATGTCCTCTTTC R/ GTTGCTGTAGTAGTCGGTGTCC

mPEPCK     F/ CTTCTCTGCCAAGGTCATCC R/ TTTTGGGGATGGGCAC

mGys1 F/ TATCGCTGGCCGCTATGAGTT R/ CACTAAAAGGGATTCATAGAG

mPGC1α      F/ GAGTCTGAAAGGGCCAAGC R/ GTAAATCACACGGCGCTCTT

mCPT1α F/ ACGGAGTCCTGCAACTTTGT R/ GTACAGGTGCTGGTGCTTTTC

 

C2C12:

mIR  F/ AATGGCAACATCACACACTACC R/ CAGCCCTTTGAGACAATAATCC

mGLUT4    F/ ACATACCTGACAGGGCAAGG R/ CGCCCTTAGTTGGTCAGAAG

mGys1         F/ TATCGCTGGCCGCTATGAGTT R/ CACTAAAAGGGATTCATAGAG

mPDK4 F/ GATTGACATCCTGCCTGACC R/ CATGGAACTCCACCAAATCC

mPGC1α F/ GAGTCTGAAAGGGCCAAGC R/ GTAAATCACACGGCGCTCTT

 

 

2.9 Statistical analysis:

The data was analysed using Graph pad Prism version 7 software (Inc., USA), and expressed as a means ± standard errors of mean of 3 independent experiments. One-way analysis of variance (ANOVA) followed by Tukey’s post-hoc test for multiple comparison was used. The significant differences were specified as *, **, ***, and **** when the P values< 0.05, 0.01, 0.001, and 0.0001 respectively.

 

3. RESULTS:

3.1 Green tea extract increases cellular 2-NBDG  uptake:

Measurement of cellular glucose uptake using fluorescent glucose analog (2-NBDG) is a widely and successfully method used to monitor glucose movements in vitro²¹. Therefore, the cellular 2-NBDG uptake was determined in 3T3-L1, AML12, and C2C12 cells after 6h exposed to 50, 100, and 150 mg/ml of green tea extract. This shorter time of exposure showed that these concentrations of green tea extract significantly increased cellular glucose uptake in these cell lines respectively compared to controls (

Figure 3.1 A-C).   

3.2 Inhibition Akt or AMPK selectively reduce cellular 2-NBDG uptake:

The signalling pathways of increased cellular glucose uptake in response to green tea extract in all cell lines were investigated by inhibiting central glucose metabolism pathways Akt and AMPK separately. Therefore, cells were treated with 100 mg/ml of green tea and co-incubated with selective Akt or AMPK inhibitor molecules for 12h. Inhibition Akt signalling pathway in both 3T3-L1 and AML12 cells caused significantly reduce of 2-NBDG uptake compared to green tea extract-treated cells that exhibited a significant increase in glucose uptake compared to control. Whereas, suppressed AMPK signalling pathway in C2C12 cells significantly decrease cellular glucose uptake compared to cells that exposed to green tea extract that showed significantly elevated 2-NBDG uptake compared to control control (

Figure 3.1D-F).

 

 

Figure 3.1 Green tea increases glucose uptake through selectively activation PI3K/Akt or AMPK in insulin-sensitive cells.

The impact of green tea extract on glucose uptake was initially investigated in (A) 3T3-L1 cells, (B) AML12 cells, (C) C2C12 cells by estimating the cellular 2NBDG uptake after 6h incubation. Secondly, the role of Akt and AMPK signaling on enhanced glucose uptake by green tea was explored in (D) 3T3-L1 cells, (E) AML12 cells, (F) C2C12 cells by co-incubating green tea-treated cells with either Akt or AMPK selective inhibitor for 12h followed by measuring 2NBDG uptake. Data present means ± SEM, n=3. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.

 

3.3 Green tea extract increases glycogen in AML12 cells:

Cellular concentration concentration of hepatic glycogen was investigated in response to green tea extract after 24 and 48h of treatment. The result showed that 50, 100, and 150mg/ml of green tea boosted theglycogen content by 77.5% ± 11.2% (p=0.0239), 115% ± 5.3% (p=0.0005), and 106.5% ± 10.2% (p=0.0015) after 24h and 75.8% ± 4.4% (p=0.0267), 135.7% ± 6.6% (p<0.0001), and 89.6% ± 6.4% (p=0.0059) after 48h compared to control respectively (

).

 

Figure 3.2 Green tea extract increases glycogen content in AML12 cells.

The effect of green tea extract on glycogen content of AML12 cells was determined after exposed cells to a various concentration of green tea extract (A) for 24h of incubation and (B) for 48h of incubation. Data present means ± SEM, n=3. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.

 

                          A                                           B                                                         C                                              D

Figure 3.3 Triglyceride oil red O staining during 3T3-L1 differentiation.

The oil red O staining was performed in 3T3-L1 to monitor lipid accumulation during the differentiation process. The lipid droplets are formed and stained red after inducing the differentiation, and their size and number are continuously increased for two weeks. (A) Day 6 of differentiation and staining. (B) Day 9. (C) Day 12. (D) Day 15. The images captured at 100x magnification using Leica DMI4000 B and Ceti Inverso TC100 inverted microscopes.

 

3.4. Green tea extract decreases cellular triglyceride in adipocytes:

3T3-L1 is pre-adipocytes which exposed to essential adipogenic 3T3-L1 is pre-adipocytes which exposed to essential adipogenic agents to become mature adipocytes. This process of differentiation is characterised by the formation of lipid droplets with triglyceride enclosed which increased in size and amount of triglyceride during differentiation. The lipid droplets formation and triglyceride accumulation during a different time of differentiation process were investigated by oil red o dye. Cells exhibited various size of multi-lipid droplets with accumulated triglyceride after six days from differentiation process initiation (                          A                                               B                                                        C                                              D

Figure 3.3).  

 

Estimating cellular triglyceride level of mature adipocytes is an essential marker to monitor glucose utilisation (adipogenesis) in adipocytes²². Therefore, the triglyceride content of adipocytes was determinedin response to green tea extract treatment at two different incubation time.Cells exposed to 50, 100, and 150 mg/ml of green tea extract exhibited significant reduction of triglyceride by 21.2% ± 4.7%, 24.9% ± 6.9%, and 24.6% ± 10.6% after 24h, and 36.6% ± 10.4%, 45.8% ±19.2%, and 34.2% ± 18% after 48h compared to controls respectively (

Figure 3.4 A & B). As expected, the result shows the proper impact of isoprenaline to reduce triglyceride, while insulin showed a unique and unlikely impact on the cellular level of triglyceride.

 

 

3.5 Green tea extract decreases glycerol release from adipocytes:

Measuring the rate of lipolysis by estimating the amount of glycerol released from mature adipocytes is an important marker of screening lipid metabolism²². As the cells released glycerol in the medium, therefore its level in green tea extract treated and control cells medium was investigated.The amount of released glycerol was significantly reduced by 41.1% ± 15%, 49.2% ± 16%, and 40.4% ± 16.8% after 24h and 31.4% ± 8.5%, 39% ± 15.7%, and 35% ± 14.3% after 48h in response to 50, 100, and 150 mg/ml green tea extract compared to controls respectively (

Figure 3.4C & D).

 

 

Figure 3.4 Green tea extract suppresses triglyceride formation and reduces glycerol released in adipocytes.

The effect of green tea extract on adipogenesis and lipolysis was investigated in adipocytes by estimating the amount of cellular triglyceride and glycerol released after 24 and 48h treatment with various concentrations of green tea. The level of cellular triglyceride after (A) 24h and (B) 48h of incubations. The level of glycerol released after (C) 24h and (D) 48h of incubation. Data present means ± SEM, n=3. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.

 

3.6 Impact of green tea extract on cell viability of metabolic cell lines:

The impact of various concentrations of green tea extract on cells number of cultured metabolic cell lines was determined during two incubation periods. The result of this analysis provides a clear explanation to understand the link between the previous positive effects of green tea extract and the viable cells number. The result showed that the cell viability of experimental cell lines was unaffected by any concentration of green tea extract
after 24h treatment. While, after 48h only 150 mg/ml of green tea extract caused few but significant reduction in viable cells by 1.2% ± 0.15, 1.5% ± 0.2%, and 1.7% ± 0.16% in 3T3-L1, AML12, and C2C12 respectively compared to controls (Figure 3.5).

 

 

 

 

Figure 3.5 Cytotoxic effect of green tea extract on insulin-sensitive cell lines.

The impact of green tea extract on cell viability of insulin-sensitive cell lines was investigated. Cells were exposed to various concentrations of green tea, and viable cells were measured using PrestoBlue™ cell viability reagent. Cell viability of 3T3-L1 cells after (A) 24h and (B) 48h of incubation. Cell viability of AML12 cells after (C) 24h and (D) 48h of incubation. Cell viability of C2C12 cells after (E) 24h and (F) 48h of incubation. Data display % of control and present means ± SEM, n=3. *p<0.05, **p<0.01, ****p<0.0001.

 

3.7 Green tea extract regulates some glucose and lipid metabolism gene:

It is precisely that the data of present work showed critical physiological changes in glucose and lipid metabolism in response to green tea extract. Therefore, the expression level of some transcriptional factors that closely related to glucose and lipid metabolism that mentioned previously in materials and methods was investigated in experimental insulin sensitive cell lines that treated with green tea extract using qRT-PCR to provide a support mechanism of these changes. The result showed that the green tea extract upregulated IR and GLUT4, and down regulated LPL, FASN, FABP4, C/EBPα, and SREPB1c mRNAs expression in adipocytes. While, hepatocytes exhibited increases of IR, GLUT2, and GyS1 and decreases of G6Pase and PEPCK gene expression. Moreover, green tea upregulated GLUT4 and GyS1 and down regulated PDK4 gene expression in C2C12 cells (Table 3.1).

 

Table 3.1 Green tea regulates most glucose and lipid metabolism transcriptional factors in insulin-sensitive cell lines.

     A

mRNA	Treatment	↑↓ Fold of control	P value
IR	Insulin	1.9 ± 0.12	0.0003 (***)
	GT	1.7 ± 0.05	0.0018 (**)
Glut4	Insulin	2.1 ± 0.15	0.0004 (***)
	GT	1.7 ± 0.05	0.0051 (**)
LPL	Insulin	0.5 ± 0.06	0.0005 (***)
	GT	0.7 ± 0.03	0.0060 (**)
PPARγ	Insulin	1.5 ± 0.09	0.0029 (**)
	GT	1.3 ± 0.02	0.0189 (*)
SREBP1c	Insulin	1.8 ± 0.19	0.0053 (**)
	GT	0.9 ± 0.07	0.7343 (NS)
FASN	Insulin	0.7 ± 0.02	0.0001 (***)
	GT	0.8 ± 0.03	0.0017 (**)
FABP4	Insulin	0.6 ± 0.03	0.0002 (***)
	GT	0.7 ± 0.03	0.0009 (***)
FABP4	Insulin	1.6 ± 0.05	0.0011 (**)
	GT	0.8 ± 0.09	0.0578 (NS)

   

 B

mRNA	Treatment	↑↓ Fold of control	P value
IR	Insulin	7.5 ± 0.72	0.0001 (***)
	GT	5.6 ± 0.20	0.0007 (***)
Glut2	Insulin	3.7 ± 0.16	0.0002 (***)
	GT	2.8 ± 0.31	0.0019 (**)
Gys1	Insulin	3 ± 0.09	0.0017 (**)
	GT	3.4 ± 0.38	0.0007 (***)
PEPCK	Insulin	0.4 ± 0.03	0.0001 (***)
	GT	0.6 ± 0.06	0.0026 (**)
G6Pase	Insulin	0.4 ± 0.05	<0.0001 (****)
	GT	0.8 ± 0.01	0.0136 (*)
CPT1α	Insulin	1 ± 0.01	0.9993 (NS)
	GT	1 ± 0.05	0.1319 (NS)
PGC1α	Insulin	1 ± 0.02	0.9473 (NS)
	GT	1 ± 0.05	0.4243 (NS)

 

     C

RNA	Treatment	↑↓ Fold of control	P value
IR	Insulin	1.2 ± 0.11	0.2137 (NS)
	GT	1.2 ± 0.03	0.3292 (NS)
Glut4	Insulin	2.5 ± 0.21	0.0009 (***)
	GT	2.5 ± 0.15	0.0008 (***)
PDK4	Insulin	0.5 ± 0.02	<0.0001 (****)
	GT	0.7 ± 0.05	0.0025 (**)
PGC1α	Insulin	1.3 ± 0.08	0.0880 (NS)
	GT	1.3 ± 0.10	0.0806 (NS)
Gys1	Insulin	1.6 ± 0.09	0.0295 (*)
	GT	1.7 ± 0.19	0.167

Cultured cells were serum starved up to 2h and then exposed to 100 mg/ml of green tea extract for 24h. Total RNA was isolated using Trizol^® reagent, and subsequently, 1μg was subjected to cDNA synthesis. The amplification level of some glucose and lipid metabolism mRNA  was quantified using SYBR^® Green qPCR in (A) 3T3-L1 cells, (B) AML12 cells, and (C) C2C12 cells. Data express relatively fold of control of gene expression that normalised to housekeeping gene Actin and present mean ± SEM, n=4. ^NSP˃0.05, *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.

 

4. DISCUSSION:

Regulation of cellular glucose metabolism is fundamentally contributed towards maintaining normal circulatory blood glucose levels². Disruption of this process leads to accumulated of the unsustainable amount of circulatory glucose, which can increase the incidence of type 2 diabetes responding to insufficient insulin secretion and reduction of insulin sensitivity³. Thus, identifying any metabolite remnant molecules possesses health beneficial properties including the ability to regulate glucose and lipid metabolism is essential with increasing prevalence of type 2 diabetes. Green tea and its active constitutes reported to have several health properties, and have been widely used to regulate glucose and lipid metabolism^{16, 19}. However, the mechanism of its effects needsto be investigated. The present study thus attempted to identify the proper impacts of crude extract of green tea on glucose and lipid metabolism in insulin-sensitive cell lines and the possible mechanism of these effects.

 

Several studies have been identified that the green tea or its active ingredients increased glucose uptake in different cell lines including hepatocytes²³, myocytes^{24, 25}, and in adipocytes²⁶. These studies reported that the glucose uptake is promoted by increasing expression and translocation of GLUTs on the cell surface which allowed the glucose to transport inside the cells. Therefore, the initial experiment of the present study demonstrated the cellular glucose uptake in insulin-sensitive cells in response to green tea extract. The result showed that the shorter exposure of green tea extract significantly increased glucose uptake in all three cell lines (

Figure 3.1). This result is associated with significant upregulated transcriptional factor GLUT4 in 3T3-L1 and C2C12 cells, and GLUT2 in AML12 cells (Table 3.1). The resultindicates that the green tea could clear acute high circulatory blood glucose through GLUTs activities and therefore could manage prediabetic and diabetes conditions.

 

PI3K/Akt and AMPK are the central and exclusive signalling pathways that involved in the regulation of glucose and lipid metabolism²⁷. Insulin is mainly activated PI3K/Akt and downstream cascades to regulate glucose and lipid metabolism²⁸. While, the green tea believed to boost glucose uptake by GLUTs translocation and further regulated glucose and lipid metabolism through activation of AMPK and downstream signalling pathway¹⁶, however, limited studies identified that the green tea regulated glucose and lipid metabolism through activation insulin dependent pathway¹⁷. As a part of exploring the mechanism of the previous effect of green tea, selective Akt and AMPK inhibitor molecules were supplemented separately to culture cells that treated with green tea to suppress

glucose uptake. Inhibition Akt significantly reduced glucose uptake in both 3T3-L1 and AML12 cells, whereas reduction of glucose uptake was seen in C2C12 cells in response to AMPK inhibitor (

Figure 3.1D – F). These results suggested that the green tea selectively promoted glucose uptake in various insulin sensitive cell lines and this may occur through activating multi-signalling pathways.  Based on that, green tea may activate PI3K/Akt pathway in 3T3-L1 and AML12 cells, and AMPK in C2C12 cells to increase glucose uptake.

 

Further exploring the mechanism of green tea to regulate glucose metabolism in C2C12, GyS1, and PDK4 gene was measured. The result showed an increased expression of GyS1 and reduced PDK4 gene expression (Table 3.1). Thisresult indicated that the green tea might regulate skeletal muscles glucose metabolism in diabetes and insulin resistance conditions that exhibited a high level of PDK4 expression²⁹.

 

Under the effect of insulin, the glucose is metabolized to glycogen in hepatic tissue associated with inhibited hepatic glucose production. This process is often impaired in a diabetic condition which caused inhibit glucose uptake in response to insulin insensitivity and therefore suppress glycogen formation alongside increase hepatic glucose released through activating glycogenolysis and gluconeogenesis key gene. Limited studies have been explored this process,and the results showed green tea increased hepatic glycogen content through activating GS gene^{30, 31}, while others showed no effect on hepatic glycogen content³². However, suppressed hepatic glucose production through regulating G6Pase and PEPCK gene was identified in response to green tea³³. The result of the current study showed that green tea extract upregulated GyS1 gene (Table 3.1) and thus significantly increased glycogen content in AML12 cells (

). This result was associated with downregulated G6Pase and PEPCK gluconeogenesis key gene that suppressed hepatic glucose production (Table 3.1).  It seems that the green tea activated insulin dependent pathway in AML12 cells

to produce this effect. This result is interesting as it may firstly establish in limited uses AML12 cells, and entirely could manage excessive hepatic glucose production a significant marker of diabetes.

 

Adipose tissue metabolises glucose into triglycerides through lipogenesis process and inhibits glycerol and free fatty acid release by lipolysis process by the effect of insulin³⁴. Disruption of glucose and lipid metabolism in adipose tissue occurs due to insulin resistance and diabetes which remarkably increased lipolysis rate.  Recent studies identified that green tea suppressed adipogenesis and pre-adipocyte growth and differentiation^{35, 36}, as well as increased lipolysis and therefore reduced the level of triglyceride^{22, 37}. However, limited studies showed that the green tea reduced lipolysis rate through a reduction in glycerol and free fatty acid released in mature 3T3-L1³⁸. These effects are mainly mediated through regulation of the expression of C/EBP-α, PPAR-γ, SREBP-1c, FABP4, LPL and FAS transcriptional factors²². The current study, therefore, investigated the effect of green tea extract on adipogenesis and lipolysis in mature adipocytes and the possible mechanism of this effect. Green tea shows ability to inhibit adipogenesis through suppressing more triglyceride formation, alongside a marked reduction in lipolysis as the level of glycerol was significantly reduced (

Figure 3.4). These results were associated with significantly downregulated of C/EBPα, SREPB1c, FASN, FABP4, LPL gene expression (Table 3.1). These results indicated that the green tea regulated essentialadipogenic and lipolytic gene as a mechanism to suppressed triglyceride formation, and glycerol and free fatty acid released. The result is fascinating as the high rate of lipolysis to release FFA is a definite marker of diabetes, which could be managed by green tea through preventing more FFA released and therefore ameliorating diabetes. Furthermore, green tea acts as anti-adipogenic and thus could help to prevent obesity.

 

Several studies reported the cytotoxic effect of high concentration of green tea and its active compounds in various cell line^{39, 40}. To investigate whether the previous biological changes in all cell lines in response to green tea are due to alteration in the cell numbers or not. The cell viability assay was performedon all cell line that treated with 50, 100, 150 mg/ml of green tea for 24 and 48h. Neither concentration nor 24h incubation altered cell number of all experimental cell lines. However, only 150 mg/ml for 48h caused few but significant reductions in cell viability in all cell lines (Figure 3.5). It seems that even with the remarkable reduction in cells number particularly related to 150 mg/ml of green tea, several positive biological changes were displayed. However, this cytotoxic concentration of green tea was excluded when measured gene expression.    

 

To conclude, green tea could be a therapeutic agent to regulate impairment glucose and lipid metabolism in insulin resistance and diabetes, in addition to potential anti-obesity effect. These impacts are promoted through selectively activation either PI3K/Akt or AMPK and their downstream signalling cascades.

 

5. ACKNOWLEDGMENTS:

I would like to thank dr. James Brown for his support and guide during this study and extended thank to Aston Research Centre for Healthy Ageing (ARCHA) facility manager for assistance at some points.

 

6. CONFLICT OF INTEREST:

The authors declare that they are contributed equally in this work and the manuscript has been read and approved by them, therefore there were no conflict of interest.  

 

7. REFERENCES:

1.        Gong Z, Muzumdar RH. Pancreatic function, type 2 diabetes, and metabolism in aging. International journal of endocrinology. 2012; 2012: 1-12.

2.        Saltiel A, Kahn C. Insulin signalling and the regulation of glucose and lipid metabolism. Nature. 2001; 414: 799-806.

3.        Bano G. Glucose homeostasis, obesity and diabetes. Best Practice & Research Clinical Obstetrics and Gynaecology. 2013; 27: 715–26.

4.        Rupashri, SV, Gheena, S. Recent advances in diabetes research. Res. J. of Pharm. and Tech. 2016; 9(10):1806-1808.

5.        Kumari, MS, Babu, MK, Sulthana, R, Svinivas, M, Prasanthi, Ch. Diabetes mellitus: present status and drug therapy updates. Res. J. of Pharm. and Tech. 2014; 7(1):84-94.

6.        Samidha, K, Vrushali, K, Management of diabetes: A review. Res. J. of Pharm. and Tech. 2014; 7(9): 1065-1072.

7.        Vuong QV. Epidemiological evidence linking tea consumption to human health: a review. Critical reviews in food science and nutrition. 2014; 54(4): 523-36.

8.        Anil PV, Mahesh MP. Global Production and Prospective of Green Tea. Asian J. Management 2013; 4(4): 297-300.

9.        Chacko SM, Thambi PT, Kuttan R, Nishigaki I. Beneficial effects of green tea: a literature review. Chinese medicine. 2010; 5: 13.

10.      Patel, RN, Patel, UY, Jyotisen, D. Polyphenol antioxidants of green tea as free radical scavengers in gree heart nanotechnology. Res. J. of Scien. and Tech 2010; 2(5): 89-94.

11.      Khan, MY, Aziz, I, Bhari, B, Kumar, H, Roy, M, Verma, VK. A review- phytomedicines used in traetment of diabetes. Asian J. of Pharm. Res 2014; 4(3): 135-154.

12.      Abdel-Rahman A, Anyangwe N, Carlacci L, Casper S, Danam RP, Enongene E, et al. The safety and regulation of natural products used as foods and food ingredients. Toxicological sciences : an official journal of the Society of Toxicology. 2011; 123(2): 333-48.

13.      El-Shahawi MS, Hamza A, Bahaffi SO, Al-Sibaai AA, Abduljabbar TN. Analysis of some selected catechins and caffeine in green tea by high performance liquid chromatography. Food chemistry. 2012; 134(4): 2268-75.

14.      Amurdhavani, B.S. Benefits of green tea in dentistry- A review. Res. J. of Pharm. and Tech 2015; 8(6): 772-774.

15.      Patil, L., Balaraman, R. Protective effect of green tea extract on chemically induced testicular damage in rats. Res. J. of Pharm. and Tech 2009; 2(4): 837-841.

16.      Babu PV, Liu D, Gilbert ER. Recent advances in understanding the anti-diabetic actions of dietary flavonoids. The Journal of nutritional biochemistry. 2013; 24(11): 1777-89.

17.      Roghith K, Karpagam K. Evaluation of Lipid Profile Based on Consumption of Green Tea – A Systematic Review. Research J. Pharm. and Tech 2016; 9(8): 1277-9.

18.      Preethi, PJ. Herbal medicine for diabetes mellitus: A review. Asian J. Pharm. Res. 2013; 3(2): 57-70.

19.      AL-Shaeli SJ. The effect of green tea extract compounds on regulation of glucose homoeostasis in insulin-sensitive and breast cancer cells [PhD thesis]. UK: Aston University; 2017.

20.      Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods (San Diego, Calif.). 2001; 25(4): 402-8.

21.      O'Neil RG, Wu L, Mullani N. Uptake of a fluorescent deoxyglucose analog (2-NBDG) in tumor cells. Molecular imaging and biology : MIB : the official publication of the Academy of Molecular Imaging. 2005; 7(6): 388-92.

22.      Lee MS, Kim CT, Kim IH, Kim Y. Inhibitory effects of green tea catechin on the lipid accumulation in 3T3-L1 adipocytes. Phytotherapy research : PTR. 2009; 23(8): 1088-91.

23.      Cordero-Herrera I, Martin MA, Goya L, Ramos S. Cocoa flavonoids attenuate high glucose-induced insulin signalling blockade and modulate glucose uptake and production in human HepG2 cells. Food and chemical toxicology : an international journal published for the British Industrial Biological Research Association. 2014; 64: 10-9.

24.      Deng YT, Chang TW, Lee MS, Lin JK. Suppression of free fatty acid-induced insulin resistance by phytopolyphenols in C2C12 mouse skeletal muscle cells. Journal of agricultural and food chemistry. 2012; 60(4): 1059-66.

25.      Subramanian, SP, Prasath, GS. In vitro glucose uptake activity of resveratrol by upregulating the expressions od Glut4, PI3 Kinase and PPARγ in L6 myotubes. Asian J. of Res. in Chemistry 2011; 4(8): 1318-1323.

26.      Ueda M, Furuyashiki T, Yamada K, Aoki Y, Sakane I, Fukuda I, et al. Tea catechins modulate the glucose transport system in 3T3-L1 adipocytes. Food & function. 2010; 1(2): 167-73.

27.      DeFronzo RA, Tripathy D. Skeletal Muscle Insulin Resistance Is the Primary Defect in Type 2 Diabetes. Diabetes Care. 2009; 32: S157-S63.

28.      Whiteman EL, Cho, H. , and Birnbaum, M.J. Role of Akt/protein kinase B in metabolism. Endocrinology and Metabolism. 2002; 13(10): 444-51.

29.      Lee I-K. The Role of Pyruvate Dehydrogenase Kinase in Diabetes and Obesity. Diabetes & Metabolism Journal. 2014; 38(3): 181-6.

30.      Sundaram R, Naresh R, Shanthi P, Sachdanandam P. Modulatory effect of green tea extract on hepatic key enzymes of glucose metabolism in streptozotocin and high fat diet induced diabetic rats. Phytomedicine : international journal of phytotherapy and phytopharmacology. 2013; 20(7): 577-84.

31.      Kim JJ, Tan Y, Xiao L, Sun YL, Qu X. Green tea polyphenol epigallocatechin-3-gallate enhance glycogen synthesis and inhibit lipogenesis in hepatocytes. BioMed research international. 2013; 2013: 1-8.

32.      Islam MS, Choi H. Green tea, anti-diabetic or diabetogenic: A dose response study. BioFactors. 2007; 29(1): 45-53.

33.      Yasui K, Miyoshi N, Tanabe H, Ishigami Y, Fukutomi R, Imai S, et al. Effects of a catechin-free fraction derived from green tea on gene expression of gluconeogenic enzymes in rat hepatoma H4IIE cells and in the mouse liver. Biomed Res-Tokyo. 2011; 32(2): 119-25.

34.      Duncan RE, Ahmadian M, Jaworski K, Sarkadi-Nagy E, Sul HS. Regulation of lipolysis in adipocytes. Annual review of nutrition. 2007; 27: 79-101.

35.      Ying CC. Effects of (-)-epigallocatechin gallate in 3T3-L1 adipogenesis. Hong Kong: University of Hong Kong; 2009.

36.      Moon H-S, Chung, Chung-Soo,  Lee, Hong-Gu, Kim, Tae-Gyu,Choi, Yun-Jaie, and  Cho, Chong-Su,. Inhibitory Effect of ( )-Epigallocatechin-3-Gallate on Lipid Accumulation of 3T3-L1 Cells. Obesity. 2007; 15(11): 2571-82.

37.      Cunha CA, Lira FS, Rosa Neto JC, Pimentel GD, Souza GI, da Silva CM, et al. Green tea extract supplementation induces the lipolytic pathway, attenuates obesity, and reduces low-grade inflammation in mice fed a high-fat diet. Mediators of inflammation. 2013; 2013: 635470.

38.      Kim JJY. Green Tea Polyphenols: a Natural Therapeutic Approach for Metabolic Syndrome and Diabetes Prevention. Sydney, Australia: University of Technology 2014.

39.      Chan CY, Wei L, Castro-Munozledo F, Koo WL. (-)-Epigallocatechin-3-gallate blocks 3T3-L1 adipose conversion by inhibition of cell proliferation and suppression of adipose phenotype expression. Life Sciences. 2011; 89(21-22): 779-85.

40.      Liu Z, Li, Q., Huang, J., Liang, Q., Yan, Y., Lin, H., Xiao, W., Li, Y., Zhang, S., Tan, B., and Luo, G. Proteomic analysis of the inhibitory effect of epigallocatechin gallate on lipid accumulation in human HepG2 cells. Proteome Science. 2013; 11(32): 1-11.

 

 

 

 

 

Received on 29.01.2019           Modified on 25.02.2019

Accepted on 25.04.2019         © RJPT All right reserved