Isolation and Identification of Avian Newcastle Disease in Poultry from Karbala City, Iraq
Mohammed A. Hussein1, Emad J. Khammas2
1Department of Pathology and Poultry Disease, Faculty of Veterinary Medicine, University of Kerbala, Iraq.
2Department of Pathology and Poultry Disease, College of Veterinary Medicine, University of Baghdad, Iraq.
*Corresponding Author E-mail: mohammed.altaee776@gmail.com
ABSTRACT:
Newcastle diseases (ND) it is viral disease infected birds and it is infectious, highly contagious diseases and cause respiratory and digestive distress with neurological signs and sudden death combined with high mortality and morbidity may arrived to (93%) in field infection. In Iraq, poultry industry suffered from high mortality arrived to (90%) or more with severe respiratory distress with greenish diarrhea, neurological signs and sudden death, grossly characterized by tracheitis, with hemorrhage of Payer΄s patches, cecal tonsils and proventriculus that lead to high economic losses in poultry industry, so that the aim of this study were isolated NDV with identification by using HA-HI test and RT-PCR assays with specific designing primer. A total of 65 samples (lung, treache, spleen and intestine) were collected from organized farms in karbala city, suspected infected with NDV and after processing these samples were inoculated in to the allantoic cavity of (9-11) days old embryonated eggs with cultivation for five days then collected allantoic fluid and stored in deep freeze. The HA-HI test was conducted to identify NDV by using private antisera, twenty one samples from sixty five are infected with NDV. The molecular methods (RT-PCR) test also confirmed twenty one samples infected with NDV, Nucleotide sequences of NDV was obtained from NCBI websites and alignment with other researchers concerned in this topic.
KEYWORDS: NDV, RT-PCR and HA-HI test.
INTRODUCTION:
According to taxonomy of virus, NDV belongs to order Mononegavirales, family Paramyxoviridae and subfamily Paramyxovirinae.
The subfamily is divided into five genera: Morbillivirus, Respirovirus, Henipavirus, Rubulavirus, and Avulavirus, all avian paramyxoviruses APMVs are part of genus Avulavirus (Briand et al., 2012, Cattoli et al., 2011, Karamendin et al., 2016).R The causative agent is appears by electron microscope as a pleomorphic enveloped, roughly spherical virus with diameter between (100 – 300) nm (Shnyrova et al., 2007). It is a non-segmented, single stranded and negative-sense RNA virus. The NDV have a genome with at least three sizes: 15, 186, 15, 192 and 15, 198 nucleotides (nt) which has molecular weight of (5.7 – 5.7×10) Daltons (Alexander, 1997, Xiao et al., 2012).
NDV strains isolates have been classified into three groups or genotypes velogenic and mesogenic strains (virulent NDVs) and lentogenic strains (low or a virulent NDVs) based on the phylogenetic analysis of the partial or complete nucleotide sequences of the fusion (F) gene (Cattoli et al., 2010, Snoeck et al., 2009, Perozo et al., 2008).
Newcastle disease may vary from subclinical to severe or systemic infection with high mortality rate depending on the virulence of virus strain and the host state and susceptibility. Based on the clinical symptoms in chicken, the NDV is grouped in to five pathotypes including viscerotropic velogenic (highly virulent), neurotropic velogenic (highly virulent), mesogenic (moderately virulent), lentogenic respiratory (low virulent) and asymptomatic enteric (a virulent). (Alexander and Senne, 2008). NDV was isolate by inoculated the suspected samples into embroynated eggs or cell cultures serves as important for viral isolation (Aldous and Alexander, 2001).
Molecular techniques such as polymerase chain reaction (PCR) have been used for rapid and sensitive detection for pathogen for example Newcastle disease (Hewson, et al., 2009). The reverse transcriptase RT-PCR is done based on principle that it has the ability to amplify and differentiate multiple specific nucleic acids using polymerase enzymes. However, those techniques can detect only one specific pathogen at a time (Bellau, et al., 2005; Albert, et al., 2013). RT-PCR can detect virus following the growth of virus in embryonated eggs in the laboratory and clinical specimens (Creelan et al., 2002).
In Iraq, ND is endemic since 1968 and was first isolated from Abo – Ghraib area (Russell and Alexander,1983), In 1978 NDV is isolated from a pigeon and identified as avian paramyxovirus-1 and identical with characteristics of NDVs (Kaleta et al., 1985). In 2013 Al – mohana et al. were diagnosis the NDV and AIV in Al – Najaf province by using RT – PCR. Poultry industry in Iraq still suffer from severe infections with respiratory and neurological signs accompanied by high mortality with sudden death so that poultry industry become exposed to highly economic losses. So the study was approved for isolation of NDV from chicken in Karbala city, and the study is designed as follows. Isolation of NDV from infected flock, Identification NDV by HA-HI test and revers transcription polymer chain reaction RT-PCR.
MATERIALS AND METHODS:
Samples collection:
Four hundred and seventy - Five pooled tissue samples were collected Between December 2016 and July 2017 from Sixty - Five vaccinated or non-vaccinated Broilers and Layers flocks from Karbala province, these flocks suffered from respiratory distress (rales, sneezing, coughing and wet eyes), greenish diarrhea and/or nervous manifestations with high morbidity and mortality may be arrived to (30% - 70%). Moribund birds were subjected to necropsy and tissue samples were collected including (lungs, trachea, spleen, Payer΄s batches and cecal tonsils). These samples were stored in labeled falcons and transported immediately with ice to the veterinary microbiology laboratory/Karbala university and stored at (-80°C) until processing and virus isolation.
Virus isolation:
Virus isolation was performed according to the protocol adopted by (OIE, 2012). Tissue samples from each flock are grinding in an autoclaved pestle and mortar with sterile phosphate buffer saline pH (7.0–7.4) and sterilized sand (50 gm/ml). Suspensions of organs were first centrifuged in a cooling centrifuge at 3000 rpm for 15 min at 4 °C. The supernatant was collected and filtered through mile pore filter (0.20μm) in the same time the air space of (9-10) days old embryonated eggs was marked off and a suitable site of injection was picked on the egg shell where no important blood vessels were running and sterilized with ethanol 70%, then a volume 0.2 ml of the supernatant was inoculated into the allantoic cavity by using insulin syringe via air space of four (9-10) days-old embryonated chicken eggs and negative control injected with 0.2μl PBS only, the puncture hole in the egg was sealed by melted paraffin and incubated at (37°C) with daily checking by candelling for viability. Deaths on the first (24hr) post inoculation (PI) were considered nonspecific death and neglected, while recorded deaths after more than (24hr) to (120hr) post inoculation. The allantoic fluid (AF) from dead and surviving embryos were harvested after overnight chilling at (4 ͦ C) in refrigerator with a sterile syringe and centrifuged at 3000rpm for 3 minutes to remove mixed blood and tissues debris and stored in sterile screw-capped vials at ( -20 or - 80°C) till further use. Presence of virus was confirmed by HA test, then second passage by using SPF eggs were conducted with samples give positive result with HA test only and also the allantoic fluid (AF) from dead and surviving embryos were harvested after overnight chilling at (4 ͦ C) in refrigerator with a sterile syringe and centrifuged at 3000rpm for 3 minutes to remove mixed blood and tissues debris and stored in sterile screw-capped vials at ( - 80°C) (Alexander, 2009).
Haemagglutination HA-HI test:
The HA-HI tests were carried out according to OIE-Manual 2012.
Reverse Transcription Polymerase Chain Reaction (RT-PCR):
Viral RNA Extraction:
The total viral RNA was extracted from harvested AF by Automated total RNA extraction (Magnisia 16 close system) with using Magnesia viral nucleic acid extraction kit. The extracted RNA was normalized for (100 ng ⁄μ) by nanodrop. The eluted RNA was used directly in CDNA amplification (F gene for NDV).
2. Oligonucleolide Primers designing:
Primers were designed for NDV (F-gene) according to MEGA- 5 program after making alignment with DNA sequencing of several strains taken from NCBI (National Center for Biotechnology Information) https://www.ncbi.nlm.nih.gov/nuccore with regard to the conserved regions and cleavage site of F gene.
F - gen for NDV: The first primer is forward composed from 19 base pair 5’ TTGATGGCAGGCCTCTTGC 3’ and reverse primer composed from 21 base pare 5’ GACCACAAATCACTTCACCTG 3’. These primers were used for amplification of 591 bp PCR product.
PCR amplification of F gene:
The CDNA product (20 μl) was thawed and used completely in total PCR reaction (40 μl) with (20μl of master mix 2X Taq polymerase abm company, Canada) and spin down gently then placed in ( Sure cycler 8800 PCR apparatus) according to the following, initial denaturation at 95 ͦ C for 3 min, followed by 40 cycles consist of initial denaturation at 95 ͦ C for 20 Second (sec), annealing at 53 ͦ C for 35 sec, polymerization at 72 ͦ C for 35 sec then final polymerization at 72 ͦ C for 10 min and finally at 4 ͦ C infinity.
Electrophoresis of PCR products:
Five microliter of PCR products mixed with 1μl of loading dye were loaded in 1.7% Agarose gel carefully, then electrophoresed by using 50 Volt for 5 min and transferred to 120Volt for 40 min.
RESULTS AND DISCUSSION:
A total of 65 samples (Trachea, Lunge, Spleen, Payer΄s batches and cecal tonsils) were collected from 95 poultry farms (Broilers and layers) in Karbala Governorate and distributed according to the following regions as shown Figure (1).These samples were collected from infected fields with high morbidity and mortality with severe respiratory signs, it is taken from infected-live bird. Immediately, after infection and multiplication of virus ,the Viremia will have appeared and occur after that the virus spread and replication through the, liver, spleen , lungs and bone marrow, Actually , the virus released into the bloodstream and the second Viraemia will began . The signs of viremia vary depending on which type of ND virus has entered the cell, In this way ND will become a source of risk virus through the excretion into the environment via respiratory secretions and feces. (Murphy et al., 1999).
Figure (4-1): schematic diagram showed the percentage of samples isolation from different area of karbala city.
Our results of virus isolation showed some of these samples were killed embryo with pathological lesion characterized by diffusely dark red embryo, tissues of the head were filled with blood and the blood vessel over the body were prominent with dwarfing of embryo and all these pathological effects showed in the figure (2).
Figure (2) the right figure showed the control negative virus inoculation and the left figure showed the pathological effects of virus on the embryo after 48hr after virus inoculation.
The HA-HI test results was conducted directly after the allantoic fluid collecting on to all samples with control negative and the results summarized by twenty-one samples give positive result for HA and HI test in the same time, the HA-HI test was performed on allantoic fluid to confirm presence of this virus due to this virus (NDV) have ability for agglutination of RBCs because this virus have capability for adsorption in specific receptors on red blood cells RBCs to form a lattice network between the RBCs (Guan et al., 2012).
All twenty one samples were successfully amplified by using one step RT–PCR. Genes were amplified using one sets of primers. All results showed single and clear bands in 591 bp following loading of 10 μl of the PCR product stained with 1μl (1 μg/mL) of loading dye and figure (3) shows this results.
Figure (3): Agarose gel electrophoresis (2%) Showed PCR product of F- gene (591 bp) for twenty one positive strains of ND extracted from infected chickens.
Twenty one out of 95 farms (22.1%) gave positive results in HA-HI test for NDV also gave positive results in RT-PCR for F-gene in 591 bp PCR product,
REFRENSES:
1. Alexander, D.J., 2004. Newcastle disease. In Manual of Standards for Diagnostic Tests and Vaccines for Terrestrial Animals (mammals, birds and bees), 5 Ed. World organization for animal health (OIE), Paris, France, pp: 270-282.
2. Alexander, D.J., and D.A. Senne. 2008. Newcastle disease, other avian paramyxoviruses, and pneumovirus infections. In: Diseases of Poultry, 12th ed. Y.M. Saif, A.M. Fadly, J.R. Glisson, L.R. McDougald, L.K. Nolan, and D.E. Swayne, eds. Iowa State University Press, Ames, Iowa. 75–116.
3. Alexander, D. J., (1997). Newcastle disease and other paramyxoviradae infection in: Calnek BW, Barnes HJ, Beard CW, McDougald L, Saif YM, editors. Disease of poultry. Ames, Iowa: Iowa State university Press; p. 541-569.
4. Aldous EW, Alexander DJ (2001) Detection and differentiation of Newcastle disease virus (avian paramyxovirus type 1). Avian Pathol 30: 117-128.
5. Guan, M. K.; Kuo, P. C., Ching,D. C., Maw, y. l. and Hung G. L. (2012).analysis of sequence and heamagglutinin activity of the HN glycoprotein on Newcastle disease virus, J. Avian pathology. 39 (3), 235 – 244.
6. Alexander, D.J., 2009. Ecology and epidemiology of Newcastle disease. In: Avian influenza and Newcastle disease, a field and laboratory manual. In: I. Capua and D.J. Alexander, (eds.), foreword by J. Domenech and B. Vallat, Springer-Verlag, Italia. Via Decembrio, 28, I- 20137 Milan, pp: 19-26.
7. Alberts, B., Bray, D., Hopkin, K., Johnson, A., Lewis, J., Raff, M., and Walter, P. (2013). Essential cell biology. Garland Science.
8. Ali, M. Al-mohana, Haider, M. Kadhimv Alaa, H. Al- charrakh; Zainab Al- Habubi; Fadhil H. Nasir; Samer, A. Al- Hilali and Zainab, J. Hadi (2013). Molecular diagnosis of avian respiratory disease in commercial broiler chicken flocks in province of najaf, Iraq. Academic Journals, Vol.8 (26). P. 1191-1195.
9. Bellau-Pujol S, Vabret A, Legrand L, Dina J, Gouarin S, et al. (2005) Development of three multiplex RT-PCR assays for the detection of 12 respiratory RNA viruses. J Virol Methods. 126: 53-63.
10. Briand, F. X., Henry, A., Massin, P., and Jestin, V. (2012). Complete genome sequence of a novel avian paramyxovirus. Journal of virology, 86(14), 7710-7710.
11. Creelan, J. L., Graham, D. A., and McCullough, S. J. (2002). Detection and differentiation of pathogenicity of avian paramyxovirus serotype 1 from field cases using one-step reverse transcriptase-polymerase chain reaction. Avian Pathology, 31(5), 493-499.
12. Cattoli G, Susta L, Terregino C, Brown C (2011). Newcastle disease: a review of field recognition and current methods of laboratory detection. J. Vet. Diagn. Investigation 23(4):637-656.
13. Cattoli, G., Fusaro, A., Monne, I., Molia, S., Le Menach, A., Maregeya, B., Nchare, A., Bangana, I., Maina, A.G., Koffi, J.N., Thiam, H., Bezeid, O.E., Salviato, A., Nisi, R., Terregino, C., Capua, I., 2010. Emergence of a new genetic lineage of Newcastle disease virus in West and Central Africa implications for diagnosis and control. Vet. Microbiol. 142 (3–4), 168–176.
14. Russell, P. H., and Alexander, D. J. (1983). Antigenic variation of Newcastle disease virus strains detected by monoclonal antibodies. Archives of virology, 75(4), 243-253. Adi AAAM, Astawa NM, Putra KSA, Hayashi Y, Matsumoto Y (2009). Isolation and characterization of a pathogenic new castle disease virus from a natural case in Indonesia. J. Vet. Med. Sci. 72(3):313-319.
15. Hewson K, Noormohammadi AH, Devlin JM, Mardani K, Ignjatovic J (2009) Rapid detection and non-subjective characterisation of infectious bronchitis virus isolates using high-resolution melt curve analysis and a mathematical model. Archives Virol. 154: 649.
16. Karamendin, K., Kydyrmanov, A., Seidalina, A., Asanova, S., Sayatov, M., Kasymbekov, E., and Goodman, S. J. (2016). Complete genome sequence of a novel avian paramyxovirus (APMV-13) isolated from a wild bird in Kazakhstan. Genome announcements, 4(3), e00167-
17. Kaleta EF, Alexander DJ, Russell PH. The first isolation of the avian pmv‐1 virus responsible for the current panzootic in pigeons? Avian Pathol 1985; 14:553-557.
18. Perozo, F., Merino, R., Afonso, C.L., Villegas, P., Calderon, N., 2008. Biological and phylogenetic characterization of virulent Newcastle disease virus circulating in Mexico. Avian Dis. 52 (3), 472–479.
19. Snoeck, C.J., Ducatez, M.F., Owoade, A.A., Faleke, O.O., Alkali, B.R., Tahita, M.C., Tarnagda, Z., Ouedraogo, J.B., Maikano, I., Mbah, P.O., Kremer, J.R., Muller, C.P., 2009. Newcastle disease virus in West Africa: new virulent strains identified in non-commercial farms. Arch. Virol. 154 (1), 47–54.
20. Shnyrova, A.V., J.Ayllon, I. I. Mikhalyov, E. Villar, J. Zimmerberg, and Frolov, V. A. (2007).Vesicle formation by self-assembly of membrane-bound matrix protein into a fluid like budding domain. J. cell Bio.179: 627-633.
21. Ali, M. Al-mohana; Haider, M. Kadhimv; Alaa, H. Al- charrakh; Zainab Al- Habubi; Fadhil H. Nasir; Samer, A. Al- Hilali and Zainab, J. Hadi (2013). Molecular diagnosis of avian respiratory disease in commercial broiler chicken flocks in province of najaf, Iraq. Academic Journals, Vol.8 (26). P. 1191-1195.
22. Murphy, F.A., E.P.J. Gibbs, M.C. Horzinek, and M.J. Studerts, 1999. Veterinary virology, 3rd ed., California, Academic press, USA: pp. 405-409.
23. OIE (2012). Newcastle disease. Manual of Diagnostic Tests and Vaccines for Terrestrial Animals. Chapter 2.3.14. http://www.oie.int/ international-standard-setting/terrestrial-manual/access-online.
24. Zahid, A.H.; Jafar, N.S. and Al – Bana, A. S. (2005). Application of in – vivo vaccination by using Newcastle disease vaccine and Newcastle NDV vaccine plus infectious bursal disease vaccine in Iraq. The Iraqi Journal of Vet. Medicine. 12(3), 165-174.
25. Xiao S, Paldurai A, Nayak B, Mirande A, Collins PL, et al. (2013) Complete genome sequence of a highly virulent Newcastle disease virus currently circulating in Mexico. Genome Announc. 1: 01-02.
Received on 04.08.2018 Modified on 19.10.2018
Accepted on 08.11.2018 © RJPT All right reserved
Research J. Pharm. and Tech. 2019; 12(5):2229-2232.
DOI: 10.5958/0974-360X.2019.00371.8