PRIMER1: A Network Service for Tetra-Arms PCR Primer Design Based on Well-Known dbSNP

 

Dhafer A. F. Al-Koofee, Shaden M. H. Mobarak

Dept. of Clinical Laboratory Science/Faculty of Pharmacy/University of Kufa, Kufa, P.O. Box (21),

Najaf Governorate, Iraq

*Corresponding Author E-mail: dhafera.faisal@uokufa.edu.iq

 

ABSTRACT:

Summary: One of the most essential roles in polymerase chain reaction (PCR) primer design is a gene structure, predominantly for eukaryotic cells genes with numeral single-nucleotide polymorphisms (SNPs) which impose on users the discrimination between them via many techniques involving PCR. At this point, PRIMER1 is illustrated as suitable network server used for primer design to detect SNP by a simple and economical method named tetra-primer amplification refractory mutation system-polymerase chain (ARMS-PCR). In PRIMER1, the users are able to concentrate their attention on the dbSNP NCBI and primer design delineation without wasting time identifying the positions of SNPs manually configuring difficult limitation. Accessibility: PRIMER1 is freely accessible at: http://primer1.soton.ac.uk/primer1.html. The network server supports the browsers: Firefox, Chrome, Safari, Opera, and Torch.

 

KEYWORDS: SNP, Tetra-ARM-PCR, SBE, dbSNP.

 

 


A. INTRODUCTION

In eukaryotic genes, different SNPs are commonly found, and they play essential roles in genetic variation among people, and can act as biological indicators, helping scientists to set genes that are linked with disease (1). SNP in both sides for the primer design to discriminate it specifically. Accessible programs, like Primer3  (2), and SNP masker  (3), are needed frequently by users to upload, paste and manually specify the DNA sequence involving SNP. Significantly, none of these programs supports detecting specific SNP without using restriction enzyme. On the other hand, the visualization of exact SNP position makes a more direct impression and gives users further information on the spatial associations than the currently used.

 

In fact, new technological tools are developed rapidly, mainly HTML5 and JavaScript, making users familiar with designing more accurate and accepted primer for PCR.

 

 

The complicated primer designing options can be excluded or modified by a number of mouse clicks process.

 

Therefore, the researcher recommends PCR Designer for Restriction Analysis of SNPs, a web server for imagination PCR primer design on well-known reference SNP ID number (“rs#”; "refSNP cluster"). There are many prosperities that distinguish PCR Designer for Restriction Analysis of SNP genotype from other conventional PCR primer design programs: a) pasting the template DNA sequence, T-ARMS-PCR recognize FASTA sequence from dbSNP NCBI; b) Normal first allele as indicated in the source sequence, furthermore the second mutated allele could be a deletion, an insertion, and taken into consideration substitution during primer designing (Fig 1); c) rather than difficult to finding specific restriction enzyme for SNP detection, T-ARMS simple and economical protocol for SNP detection either in one tube or in separate tubes, comparison with the other genetic techniques like RFLP-PCR. This is an adept method achieved with high sensitivity and specificity.

 


 

Fig 1: Schematic drawing of tetra-primers ARMS-PCR method(4).

 


B. APPLICATION AND WEB SERVICE:

Tetra-primer ARMS-PCR is utilized to distinguish the SNPs. This methodology incorporates four primers to amplify three pieces which are absolutely visional agarose gel electrophoresis (5). The primers for ARMS-PCR are configured using a web-based program, supported for non specificity using Primer BLAST (6). In short, the accurate sequence is copied and pasted to the website. Then,  required parameters are input, including the position of the point mutation, primer size, length of the products, primer melting temperature (TM) and the GC% content. The output software gives some primer sets  (7). Each of these sets includes four primers. Thus, the primer is resulted in two forms: the 'normal' form referred to as the forward (allele-specific, wild type allele-specific) which is refractory to PCR on 'mutant' template DNA and the 'mutant' form mentioned as a reverse inner primer (allele-specific, mutant allele-specific) that is refractory to PCR on 'normal' DNA. A single 3'-mismatched base does allow amplification to proceed (8). These Four primers are necessary to amplify a larger segment from template DNA containing the SNP and two smaller segments representing each of the two specific alleles products. Primers are configured by special technique that the allelic amplicons differ in size and can be fixed by agarose gel electrophoresis (9).

The four primers are added in the same PCR tube. The outer primers produce non-allelic outer brilliant control band (higher molecular weight), while the inner two primers which are allele-specific produce two different sized bands based on the presence of the wild or mutant allele (both are of lower molecular weight compared to outer band). By employing strict PCR amplification conditions, these four primers specifically amplify either wild/mutant allele or both (10). The promotion of the specificity of the reaction achieved by addition to the first mismatch at the 3' end of allele specific primers (ASP), an extra mismatch is also designedly inserted at the third position from the 3' end of each of the two inner (ASPs) (11).

 

The program includes the following steps: (12)

1.    Copy the required sequence depending on dbSNP and then paste to a sequence text box as (FASTA format) with a size of up to 1000 base pairs which is presented 5' to 3'.

2.    Fill all the desired boxes or leave them as the default.

3.    The Further mismatch base is added by the program selecting.

4.    According to the user filling, the program output primer sets.

5.    The typical inner primer pair is known which has the nearest identification to the filling box of melting temperatures for a primer (Tm) and also the less Tm difference between the two primers.

6.    The selected outer, forward and reverse primers are agree mean Tm of the two inner primers.

 

C. DISCUSSION:

Many SNPs of eukaryotic genes identification are carried out by restriction fragment length polymorphism PCR (RFLP-PCR), depending on specific type of restriction enzyme, which is considered as an extensive task. Now, T-ARMS-PCR software is offered for SNPs primer design that does not involve restriction enzyme to help users to locate the sole position of SNP depending on the surrounded flanking sequence on each side of SNP. Nowadays,  adding interactivity to web page is a novel pattern of web using HTML5 and JavaScript. Fast progress in the performance of JavaScript and HTML5 compatible browsers leads to systematic application. In general, there are numerous scientific technical application strategies depending on the JavaScript and HTML5 ‘canvas’ element. They are presented in the current study including Anno-J (13) and ChemDoodle.

Consequently, the mixing of new technologies, the commonly used primer design software, primer 3 plus and the blast-checking program will be a helpful image for genotype SNPs detection PCR primer design tool.

 

D. APPENDICES:

Experiment Sequence:

Below, the sequence of four primers of Lipoprotein(a) gene (6q25.3-26) (NC_000006.12), polymorphism (dbSNP; rs3798220) in the 5' flanking region that can be used in the primer1 with default settings to design primers for the +93C>T polymorphism (position 5011 in this sequence).


 

Tetra-ARMS-PCR primer sets output with default setting.

***********************************************OUTPUT1*******************************************

Forward inner primer (T allele):                                              Melting temperature

476 GCTCCAAGAACAGCCTAGACACTGCT 501                                                             67

 

Reverse inner primer (C allele):

528 AACCTCGAATCTCATGTTCAGGAAAGAG 501                                                           66

 

Forward outer primer (5' - 3'):

316 TTGAGCCTTTCATGTGATAGACAGTTCC 343                                                           66

 

Reverse outer primer (5' - 3'):

714 TTGTTTCTTGCCACTCATAAGTCACTGA 687                                                           66

 

Product size for T allele: 240

Product size for C allele: 213

Product size of two outer primers: 399

 

***********************************************OUTPUT2*******************************************

Forward inner primer (T allele):                                              Melting temperature

476 GCTCCAAGAACAGCCTAGACACTGCT 501                                                             67

 

Reverse inner primer (C allele):

528 AACCTCGAATCTCATGTTCAGGAAAGAG 501                                                           66

 

Forward outer primer (5' - 3'):

317 TGAGCCTTTCATGTGATAGACAGTTCCT 344                                                           66

 

Reverse outer primer (5' - 3'):

714 TTGTTTCTTGCCACTCATAAGTCACTGA 687                                                           66

 

Product size for T allele: 240

Product size for C allele: 212

Product size of two outer primers: 398

 

************************************************OUTPUT3******************************************

Forward inner primer (T allele):                                              Melting temperature

476 GCTCCAAGAACAGCCTAGACACTGCT 501                                                             67

 

Reverse inner primer (C allele):

528 AACCTCGAATCTCATGTTCAGGAAAGAG 501                                                           66

 

Forward outer primer (5' - 3'):

319 AGCCTTTCATGTGATAGACAGTTCCTCC 346                                                           66

 

Reverse outer primer (5' - 3'):

714 TTGTTTCTTGCCACTCATAAGTCACTGA 687                                                           66

 

Product size for T allele: 240

Product size for C allele: 210

Product size of two outer primers: 396

************************************************OUTPUT4******************************************

Forward inner primer (T allele):                                              Melting temperature

476 GCTCCAAGAACAGCCTAGACACTGCT 501                                                             67

 

Reverse inner primer (C allele):

528 AACCTCGAATCTCATGTTCAGGAAAGAG 501                                                           66

 

Forward outer primer (5' - 3'):

240 TCCTTCTGCCTTTTTAAAGAGCACAACT 267                                                           66

 

Reverse outer primer (5' - 3'):

714 TTGTTTCTTGCCACTCATAAGTCACTGA 687                                                           66

 

Product size for T allele: 240

Product size for C allele: 289

Product size of two outer primers: 475

 

************************************************OUTPUT5******************************************

Forward inner primer (T allele):                                              Melting temperature

476 GCTCCAAGAACAGCCTAGACACTGCT 501                                                             67

 

Reverse inner primer (C allele):

528 AACCTCGAATCTCATGTTCAGGAAAGAG 501                                                           66

 

Forward outer primer (5' - 3'):

238 AATCCTTCTGCCTTTTTAAAGAGCACAA 265                                                           66

 

Reverse outer primer (5' - 3'):

714 TTGTTTCTTGCCACTCATAAGTCACTGA 687                                                           66

 

Product size for T allele: 240

Product size for C allele: 291

Product size of two outer primers: 477

 

************************************************OUTPUT6******************************************

Forward inner primer (T allele):                                              Melting temperature

476 GCTCCAAGAACAGCCTAGACACTGCT 501                                                             67

 

Reverse inner primer (C allele):

528 AACCTCGAATCTCATGTTCAGGAAAGAG 501                                                           66

 

Forward outer primer (5' - 3'):

237 GAATCCTTCTGCCTTTTTAAAGAGCACA 264                                                           66

 

Reverse outer primer (5' - 3'):

714 TTGTTTCTTGCCACTCATAAGTCACTGA 687                                                           66

 

Product size for T allele: 240

Product size for C allele: 292

Product size of two outer primers: 478

 

************************************************OUTPUT7******************************************

Forward inner primer (T allele):                                              Melting temperature

476 GCTCCAAGAACAGCCTAGACACTGCT 501                                                             67

 

Reverse inner primer (C allele):

528 AACCTCGAATCTCATGTTCAGGAAAGAG 501                                                           66

 

Forward outer primer (5' - 3'):

230 AGGAAACGAATCCTTCTGCCTTTTTAAA 257                                                           66

 

Reverse outer primer (5' - 3'):

714 TTGTTTCTTGCCACTCATAAGTCACTGA 687                                                           66

 

Product size for T allele: 240

Product size for C allele: 299

Product size of two outer primers: 485

 

************************************************OUTPUT8******************************************

Forward inner primer (T allele):                                              Melting temperature

476 GCTCCAAGAACAGCCTAGACACTGCT 501                                                             67

Reverse inner primer (C allele):

528 AACCTCGAATCTCATGTTCAGGAAAGAG 501                                                           66

 

Forward outer primer (5' - 3'):

250 TTTTTAAAGAGCACAACTAACATGTGGCA 278                                                          66

 

Reverse outer primer (5' - 3'):

714 TTGTTTCTTGCCACTCATAAGTCACTGA 687                                                           66

 

Product size for T allele: 240

Product size for C allele: 279

Product size of two outer primers: 465

 

************************************************OUTPUT9******************************************

Forward inner primer (T allele):                                              Melting temperature

476 GCTCCAAGAACAGCCTAGACACTGCT 501                                                             67

 

Reverse inner primer (C allele):

528 AACCTCGAATCTCATGTTCAGGAAAGAG 501                                                           66

 

Forward outer primer (5' - 3'):

239 ATCCTTCTGCCTTTTTAAAGAGCACAACT 267                                                          66

 

Reverse outer primer (5' - 3'):

714 TTGTTTCTTGCCACTCATAAGTCACTGA 687                                                           66

 

Product size for T allele: 240

Product size for C allele: 290

Product size of two outer primers: 476

 

************************************************OUTPUT10*****************************************

Forward inner primer (T allele):                                              Melting temperature

476 GCTCCAAGAACAGCCTAGACACTGCT 501                                                             67

 

Reverse inner primer (C allele):

528 AACCTCGAATCTCATGTTCAGGAAAGAG 501                                                           66

 

Forward outer primer (5' - 3'):

238 AATCCTTCTGCCTTTTTAAAGAGCACAAC 266                                                          66

 

Reverse outer primer (5' - 3'):

714 TTGTTTCTTGCCACTCATAAGTCACTGA 687                                                           66

 

Product size for T allele: 240

Product size for C allele: 291

Product size of two outer primers: 477

 


E. REFERENCES:

1.     Single-nucleotide polymorphism /SNP/ learn science at Scitable.www.nature.com. Retrieved 2015-11-13.

2.     Rozen S.,  Skaletskyh.. Primer3 on the WWW for general users and for biologist programmers , Methods Mol. Biol. , 2000, vol. 132 pg. 365.

3.     Andreson R, Puurand T, Remm M. SNPmasker: automatic masking of SNPs and repeats across eukaryotic genomes. 2006;34:651–5.

4.     Ye S, Dhillon S, Ke X, Collins AR, Day INM. An efficient procedure for genotyping single nucleotide polymorphisms. 2001;29(17).

5.     Fonseca PAS, Rosse IC, Demiranda M, Machado MA. A new tetra-primer ARMS-PCR for genotyping bovine kappa-casein polymorphisms. 2013;12(4):6521–6.

6.     Hamzeh Mesrian Tanha, Marjan Mojtabavi Naeini, Soheila Rahgozar,Seyed  Mohammad Mahdi Rasa, and Sadeq Vallian. -Primer ARMS PCR as a Single-Nucleotide Polymorphism Genotyping Tool :Modified Tetra (2015),19(3):1-6.

7.     Chen BY., Janes H.W., Chen S. Computer Programs for PCR Primer Design and Analysis. In: Chen BY., Janes H.W. (eds) PCR Cloning Protocols. Methods in Molecular Biology , 2002. vol 192. Humana Press).

8.     Newton, C.R., Graham,A., Heptinstall, L.E., Powell, S.J., Summers, C., Kalsheker, N., Smith, J.C. and Markham, A.F. (1989) Analysis of any point mutation in DNA. The amplification refractorymutation system(ARMS). Nucleic Acids Res., 17, 2503–2516

9.     Pcr A, Batchprimer T, Huo N, Gu YQ, Hane D, Dvorak J, et al. BatchPrimer3 v1.0. 2018;3–4.

10. Randhawa R, Duseja A, Changotra H. Short Communication A Novel Tetra-primer ARMS-PCR based assay for genotyping SNP rs12303764 ( G / T ) of human Unc-51 like kinase 1 gene. Mol Biol Rep [Internet]. Springer Netherlands; 2016;0(0):0. Available from: "http://dx.doi.org/10.1007/s11033-016-4087-7

11. Maheswari C, Sheebanancy K, Kavitha VJ. An in silico approach to design T-arms primers for VDR locus to detect osteoporosis. 2017;8(01):24–30.

12. Collins A, Ke X. Primer1 : Primer Design Web Service for Tetra-Primer ARMS-PCR. 2012;44(808):55–8.

13. Lister R, Malley RCO, Tonti-filippini J, Gregory BD, Berry CC, Millar AH, et al. Resource Highly Integrated Single-Base Resolution Maps of the Epigenome in Arabidopsis. 2008;523–36.

 

 

 

Received on 27.03.2018          Modified on 25.05.2018

Accepted on 31.05.2018        © RJPT All right reserved

Research J. Pharm. and Tech 2018; 11(8): 3633-3637.

DOI: 10.5958/0974-360X.2018.00669.8