Molecular Characterizations of Aminoglycoside Modifying Enzymes of Proteus mirabilis Isolated From Patients in Al-Qadisiyah Governorate
Najlaa Abdallah D. AL-Oqaili1, Majed Kadim AL-Shebli2, Azhar N. H. Almousawi3
1College of Biotechnology, University of Al-Qadisiyah, Iraq
2College of Education, University of Al-Qadisiyah, Iraq
3College of Pharmacy,University of Al-Qadisiyah, Iraq
*Corresponding Author E-mail: najlaa67890@gmail.com
ABSTRACT:
The aim of this study was evaluate the presence of modified enzymes for aminoglycosides antibiotics in Proteus mirabilis. Total of 64 clinical isolates were collected from various sources included urine, middle ear, wounds, burns, high cervical and endometrium cervical, which was taken from in patients and outpatients in Maternal, and General Teaching Hospital in AL- Diwaniya city during the period from 1/3/2015 till 30/9/2015. Select the minimum inhibitory concentration of a number of antibiotics for aminoglycosides for resistant bacterial isolates which are anti-Gentamycin, Tobramycin, Kanamycin, Streptomycin, Netlimicin the isolates showed their ability to grow in high concentrations ranging from (32-1024)µg/ml, also resisted anti-aminoglycosides and with different rates of Gentamycin, Amikacin ,Tobramycin , Kanamycin, Streptomycin, and Netlimicin, it was in varying proportions (54.68, 31.25, 76.56, 81.25, 85.93, 81.25) %, respectively .
KEYWORDS: Aminoglycoside, Modifing Enzymes, proteus mirabilis, PCR, MIC, Aminoglycoside antibiotics.
INTRODUCTION:
Proteus spp. are widely distributed in nature. They can be found in polluted water, soil and manure, where they play an important role in decomposing organic matter of animal origin [1-3]. Proteus is a genus of Gram-negative bacteria; many of which cause infections in humans [4], and about 90% of these infections are caused by P.mirabilis [5] and is mostly found in people with compromised immune system (6). It is an opportunistic pathogen that is able to cause severe invasive diseases [7] in critically ill and immunocompromised patients [8]. P. mirabilis strains can acquire various genes for antibiotic resistance via mobile genetic elements: plasmids, integrons, gene cassettes, and transposons [9].
The most common mechanism of aminoglycoside resistance is enzymatic modification of antibiotic molecule [10]. After modification, the aminoglycoside isnot able to bind to the aminoacyl site of 16S rRNA within the bacterial 30S ribosomal subunits and inhibit protein synthesis [11, 12]. Aminoglycoside - modifying enzymes (AME) have been assigned to three classes: aminoglycoside acetyltransferases (AAC), aminoglycoside phosphotransferases (APH), and aminoglycoside nucleotidyltransferases (ANT) [13]. A more specific classification includes the division into subclasses according to the region specificities for aminoglycoside modifications and spectrum of aminoglycoside resistance [14]. To the subclasses with clinical significance among Enterobacteriaceae rods belong following groups: AAC(3)-I, AAC(6’)-I, ANT(4’)-II, ANT(2”)-I, and APH(3”)-I.The subclass AAC(3)-I contributes to the resistance to gentamicin, sisomicin, and astromicin, while AAC(6’)-I shows activity against amikacin and gentamicin. Enzymes from ANT(4’)-II subclass confer resistance to amikacin, isepamicin, and tobramycin, and AME belonging to ANT(2”)-I mediate resistance to dibekacin, gentamicin, kanamycin, sisomicin, and tobramycin. The subclass of APH(3”)-I enzymes shows activity against streptomycin [10]. The other mechanisms, which also contributes in resistance to aminoglycosides, can coexist in one bacterial cell along with AME [15]. These mechanisms include methylation of 16S rRNA [16], reduced outer membrane permeability [17], efflux pumps and mutations of the ribosomal proteins or 16S rRNA [16].
MATERIALS AND METHODS:
Specimens’ collection:
Different clinical samples such as urine, wound swab, burn swab, high cervical, endometrium cervical and ear swab, which was taken from in patients and outpatients in Maternal, and General Teaching Hospital in AL- Diwaniya city during the period from 1/3/2015 till 30/9/2015. The collection process has been conducted according to [18].
Identification of Bacterial Isolates:
The isolates were identified according to [19] by using traditional microscopic examination (Gram’s stain), colony morphological features on MacConkey agar and
blood agar, and standard biochemical tests.
DNA extraction:
The total genomic DNA of the P.mirabilis was isolated using the DNA extraction and purification kit (Geneaid, USA) according to the manufacturer instructions. DNA preparations were then analyzed by electrophoresis in 1.5% agarose gel.
Polymerase chain reaction:
Polymerase chain reaction was used to amplify the entire sequences ofthe genes studied in this research. The specific primers (Bioneer, Korea)used for the amplification of these genes [20] were shown in (table 1). The PCR mixtures contained: Top DNA polymerase 1U, dNTP (dATP, dCTP, dGTP, dTTP) each: 250µM, Tris-HCl (pH 9.0) 10mM, KCl 30mM, MgCl2 1.5mM, Stabilizer and tracking dye .The cycling parameters of amplification were: Initial denaturation 95°C for 5min, Denaturation 95°C for 30 sec., Annealing (52°C) for 30 sec., Extension 72°C for 1min., Final extension 72°C for 5min.
Agarose gel electrophoresis:
The products were separated in 1.5% agarose gel in TBE buffer (pH 8), stained with ethidium bromide, and photographed in ultraviolet light [21]. The electrophoresis result noticed by using gel documentation system.
Table (1): Sequences of oligonucleotide primers used in PCR assays for amplification of genes encoding AME
|
Amplicon |
Sequence |
Primer |
|
389bp |
GGCTCAAGTATGGGCATCAT |
aac(3)-Ia |
|
TCACCGTAATCTGCTTGCAC |
||
|
300bp |
GCTCTTGGAAGCGGGGACGG |
aac(6’)-Ib |
|
TCGCTCGAATGCCTGGCGTG |
||
|
839bp |
ATCGTCTGCGAGAAGCGTAT |
ant(4’)-IIa |
|
TAAAACGCCTATCCGTCACC |
||
|
500bp |
GACACAACGCAGGTCACATT |
ant(2”)-Ia |
|
CGCAAGACCTCAACCTTTTC |
||
|
548bp |
CTTGGTGATAACGGCAATTCC |
aph(3”)-Ib |
|
CCAATCGCAGATAGAAGGCAA |
Antimicrobial susceptibility test:
Susceptibility to antimicrobial agents was determined by using the disk diffusion method [22]. The following antimicrobial agents (obtained from Bioanalyse Turkyi, Oxoid England) were used: gentamycin (GM), amikacin (AK), Tobramycin (TOB), Kanamycin (K), Netilmicin (NET) and Streptomycin (S).
Susceptibility to antimicrobial agents was determined by using the minimum inhibitory concentrations (MICs) [23]. The following antimicrobial agents (obtained from Kocaeli Turkyi, Hamburg Germany) were used: gentamycin (GM), Tobramycin (TOB), Kanamycin (K), Netilmicin (NET) and Streptomycin (S).
The inoculums were prepared by growing the various Proteus mirabilis on separate agar plates and colonies from the plate were transferred with inoculating loop into 3 ml of normal saline in a test tube. The density of these suspensions was adjusted to 0.5 McFarland standards. The surface of Muller-Hinton agar (Himedia India) plate was evenly inoculated with the organisms using a sterile swab. The swab was dipped into the suspension and pressed against the side of the test tube to remove excess fluid. The wet swab was then used to inoculate the Muller-Hinton agar by evenly streaking across the surface. The antibiotic discs were applied to the surface of the inoculated agar and the plates were incubated overnight at 37ºC. The diameter of zone of growth - inhibition observed was measured and compared to the chart provided by National Committee for Clinical Laboratory Standards (NCCLS).
RESULTS AND DISCUSSION:
Isolation and identification:
Sixty four isolates were identified as P.mirabilis consisted of 32 isolates (12.8%) obtained from urine, 17 isolates (9.18%) obtained from middle ear, 3 isolates (7.5%) obtained from wounds, 4 isolates (4.7%) obtained from burns and 8 isolates (8.88%) obtained from high cervical and endometrium cervical (table 2).
Table (2): Distribution of P.mirabilis among various clinical sources.
|
Type of samples |
No. of samples (%) |
|
Urine |
32 (12.8) |
|
Middle ear |
17 (9.18) |
|
Wounds |
3 (7.5) |
|
Burns |
4 (4.7) |
|
High cervical and endometrium cervical |
8 (8.88) |
|
Total |
64 (9.84) |
We analyzed resistance to 6 antibiotics aminoglycosides all isolates showed microbiological resistance (table 3), Gentmycin about (54.68%) this result agrees with (24) about (50%) but not agrees with [25] about (33%), also Amikacin (31.25%) this result agrees with [26] about (38.4%) but this current result not agrees with [27,24] about (1.6,5)% , respectively. Tobramycin (76.56%)this result agrees with [28] about (81%) but this current result not agrees with [29] about (33.3%). also antibiotics Kanamycin, Streptomycin and Netlimicin about 81.25, 85.93, 81.25%, respectively.
Table (3): Percentage (%) of antimicrobial resistance and sensitivity of P.mirabilis .
|
Sensitive isolates |
Resistance isolates |
Antibiotics |
||
|
(%) |
No. |
(%) |
No. |
|
|
45.31 |
29 |
54.68 |
35 |
Gentamycin |
|
68.75 |
44 |
31.25 |
20 |
Amikacin |
|
23.43 |
15 |
76.56 |
49 |
Tobramycin |
|
18.75 |
12 |
81.25 |
52 |
Kanamycin |
|
14.06 |
9 |
85.93 |
55 |
Streptomycin |
|
18.75 |
12 |
81.25 |
52 |
Netlimicin |
We analyzed resistance to five antibiotics for 20 isolates under study were subjected to test the minimum inhibitory concentrations (MICs) in (table 4), value of MIC to Gentamycin were (32-512)µg/ml this result agrees with [30 ] were MIC value (8 ≤ 512-)µg/ml, but this current result not agrees with [31] were MIC value (0.5-256) µg/ml, also Tobramycin were MIC (32-512) µg/ml which is a break point (8 ≤ ) µg/ml, this result agrees with (32) were MIC value for Tobramycin (16-512) µg/ml but this current result not agrees with [31] were MIC value (0.5-256) µg/ml , also study [30] were MIC value for Tobramycin (4-1024) µg/ml, Kanamycin in the current study were MIC vaule (32-1024) µg/ml which is a break point (16 ≤ ) µg/ml , this result approach with [31] were MIC value (2-1024) µg/ml, while Streptomycin and Netilmicin in the current study were MIC value (128-1024)µg/ml which is a break point (32 ≤ , 16 ≤ ) µg/ml, respectively.
Table (4): Minimum inhibitory concentrations (MIC) for ant P.mirabilis isolates.
|
CN 8≤ g / mlµ |
TOB 8≤ g / mlµ |
K 16≤ g / mlµ |
S 32≤ g / mlµ |
NET 16≤ g / mlµ |
Break point
|
Antibiotic
No.S. |
|
256 |
512 |
128 |
1024 |
1024 |
1 |
|
|
256 |
512 |
512 |
1024 |
1024 |
2 |
|
|
256 |
64 |
64 |
1024 |
1024 |
3 |
|
|
256 |
64 |
1024 |
512 |
128 |
4 |
|
|
512 |
32 |
1024 |
512 |
512 |
5 |
|
|
512 |
256 |
256 |
512 |
256 |
6 |
|
|
128 |
32 |
256 |
256 |
256 |
7 |
|
|
256 |
64 |
256 |
128 |
256 |
8 |
|
|
64 |
512 |
512 |
512 |
256 |
9 |
|
|
64 |
512 |
512 |
1024 |
128 |
10 |
|
|
512 |
128 |
32 |
1024 |
512 |
11 |
|
|
512 |
256 |
512 |
1024 |
1024 |
12 |
|
|
64 |
128 |
1024 |
512 |
1024 |
13 |
|
|
64 |
64 |
1024 |
1024 |
1024 |
14 |
|
|
64 |
128 |
128 |
256 |
256 |
15 |
|
|
128 |
512 |
32 |
256 |
128 |
16 |
|
|
256 |
512 |
32 |
1024 |
256 |
17 |
|
|
256 |
32 |
128 |
128 |
512 |
18 |
|
|
128 |
256 |
512 |
512 |
256 |
19 |
|
|
128 |
256 |
64 |
256 |
256 |
20 |
|
Aminoglycosides (Amgs) are highly potent, broad spectrum antibiotics with many desirable properties for the treatment of human infections. Among resistance mechanisms to Amgs inactivation by aminoglycoside-modifying enzymes (AMEs) is the most important both in terms of level and frequency of resistance conferred to the bacterium [33]. There are three family of AMEs including aminoglycoside acetyltransferases (AACs), phosphotransferases (APHs), and nucleotidyl transferases (ANTs). Each group of enzymes consists of different isozymic forms that differ in substrate regiospecificity for their reactions [33]. Amgs modification has emerged in all clinically relevant bacteria of both Gram-positive (Staphylococcus spp., Enterococcus spp.) and Gram negative, including Proteus spp. strains [33, 34, 25, 35]. These enzymes are often plasmid-encoded but may also be associated with transposable elements facilitating the rapid dissemination of the genes in various bacterial populations [33, 36]. In this study we present occurrence of modified enzymes for aminoglycosides antibiotics in clinical strains of Proteus mirabilis. The genes encoding AME were detected in 20 P.mirabilis isolates which represents five genes (Table 5). The results of the current study showed that the presence of the gene aac(3)-Ia in P.mirabilis about (20%) (Fig.1), while a study showed [37] presence the gene aac(3)-Ia about (1.51%). The presence of aac(6’)-Ib about (40%) (Fig.2) this result agrees with [38] about (36.5%), also agrees with [39] about (37.28%), but the result of the current not agree with (40) about (71.43%). While The presence of ant(4’)-IIa about (15%) (Fig.3) this result approach with [37] the presence of ant (4’)-IIa gene was not detected in any of tested isolates.
Also the presence of the gene ant(2”)-Ia about (50%) (Fig.4), while a study showed [37] about (80.30%), but not agree with (41) about (36%). Finally, the study showed that the presence of the gene aph(3”)-Ib about (50%) (Fig.5), this result not agree with [37] about (21.21%).
Table (5): Prevalence of genes encoding AME in p.mirabilis isolates
|
( % ) |
No. P.mirabilis isolates |
Genes |
|
20 |
4 |
aac(3)-Ia |
|
40 |
8 |
aac(6')-Ib |
|
15 |
3 |
ant(4')-IIa |
|
50 |
10 |
ant(2")-Ia |
|
50 |
10 |
aph(3")-Ib |
Fig.1. Demonstration of aac(3)-Ia gene resistant for antibiotic aminoglycosides with PCR in agarose gel. M: Marker ladder 100-2000bp, Lanes 1-4 positive numbers for the gene aac(3)-Ia of clinical Proteus mirabilis (80mA and 100V) for one hour.
Fig.2. Demonstration of aac(6’)-Ib gene resistant for antibiotic aminoglycosides with PCR in agarose gel. M: Marker ladder 100-2000bp, Lanes 1-8 positive numbers for the gene aac(6’)-Ib of clinical Proteus mirabilis (80mA and 100V) for one hour.
Fig.3. Demonstration of ant(4’)-IIa gene resistant for antibiotic aminoglycosides with PCR in agarose gel. M: Marker ladder 100-2000bp, Lanes 1-3 positive numbers for the gene ant(4’)-IIa of clinical Proteus mirabilis (80mA and 100V) for one hour.
Fig.4. Demonstration of ant(2”)-Ia gene resistant for antibiotic aminoglycosides with PCR in agarose gel. M:Marker ladder 100-2000bp, Lanes 1-10 positive numbers for the gene ant(2”)-Ia of clinical Proteus mirabilis (80mA and 100V) for one hour .
Fig.5. Demonstration of aph(3”)-Ib gene resistant for antibiotic aminoglycosides with PCR in agarose gel. M:Marker ladder 100-2000bp, Lanes 1-10 positive numbers for the gene aph(3”)-Ib of clinical Proteus mirabilis (80mA and 100V) for one hour
CONCLUSION:
The results show that the prevalence of resistant genes for the anti-aminoglycosides was also studied , the results were also variable for genes aac(3)-Ia ,aac(6')-Ib ,ant(4')-IIa ,ant(2")-Ia and aph(3")-Ib ,in percentages ( 20 , 40 , 15 , 50 , 50 ) % ,respectively.
REFERENCES:
1. Pagani L, Migliavacca R, Pallecchi L, Matti C, Giacobone E, Amicosante G, Romero E, Rossolini GM. Emerging extended-spectrum β-lactamases in Proteus mirabilis. Journal of clinical microbiology. 2002 Apr 1;40(4):1549-52.
2. Khan AU, Musharraf A. Plasmid-mediated multiple antibiotic resistance in Proteus mirabilis isolated from patients with urinary tract infection. Medical science monitor: international medical journal of experimental and clinical research. 2004 Nov;10(11):CR598-602.
3. Wadud A, Chouduri AU. Microbial safety assessment of municipal water and incidence of multi-drug resistant Proteus isolates in Rajshahi, Bangladesh. Current Research in Microbiology and Biotechnology. 2013 Jul;1(4):189-95.
4. Liu D. Molecular Detection of Foodborne Pathogens. CRC Press: Boca Raton. 2010.
5. Clark K, Evans L, Wall R. Growth rates of the blowfly, Lucilia sericata, on different body tissues. Forensic Science International. 2006 Jan 27;156(2):145-9.
6. Cordoba A, Monterrubio J, Bueno I, Corcho G. Severe community-acquired pneumonia due to Proteus mirabilis. Enfermedades infecciosas y microbiología clínica. 2005 Apr;23(4):249.
7. Pellegrino R, Scavone P, Umpiérrez A, Maskell DJ, Zunino P. Proteus mirabilis uroepithelial cell adhesin (UCA) fimbria plays a role in the colonization of the urinary tract. Pathogens and disease. 2013 Mar 1;67(2):104-7.
8. Kearns DB. A field guide to bacterial swarming motility. Nature reviews. Microbiology. 2010 Sep;8(9):634.
9. Bistué AJ, Birshan D, Tomaras AP, Dandekar M, Tran T, Newmark J, Bui D, Gupta N, Hernandez K, Sarno R, Zorreguieta A. Klebsiella pneumoniae multiresistance plasmid pMET1: similarity with the Yersinia pestis plasmid pCRY and integrative conjugative elements. PloS one. 2008 Mar 19;3(3):e1800.
10. Ramirez MS, Tolmasky ME. Aminoglycoside modifying enzymes. Drug Resistance Updates. 2010 Dec 31;13(6):151-71.
11. Delgado-Valverde M, Sojo-DoradoJ., Pascual A., Rodrígu¬ez-Baño J. Clinical management of infections caused by multidrug-resistant Enterobacteriaceae. Ther Adv Infect 2013 Dis. 1 (2): 49-69.
12. Magnet S, Blanchard JS. Molecular insights into aminoglycoside action and resistance. Chemical reviews. 2005 Feb 9;105(2):477-98.
13. Houghton JL, Green KD, Chen W, Garneau‐Tsodikova S. The future of aminoglycosides: the end or renaissance?. ChemBioChem. 2010 May 3;11(7):880-902.
14. Doi Y, Arakawa Y. 16S ribosomal RNA methylation: emerging resistance mechanism against aminoglycosides. Clinical Infectious Diseases. 2007 Jul 1;45(1):88-94.
15. Alekshun MN, Levy SB. Molecular mechanisms of antibacterial multidrug resistance. Cell 2007; 128: 1037-1050.
16. Galimand M, Sabtcheva S, Courvalin P, Lambert T. Worldwide disseminated armA aminoglycoside resistance methylase gene is borne by composite transposon Tn1548. Antimicrob Agents Chemother 2005; 49: 2949-2953.
17. Over U, Gur D, Unal S, Miller GH. The changing nature of aminoglycoside resistance mechanisms and prevalence of newly recognized resistance mechanisms in Turkey. Clin Microbiol Infect 2001; 7: 470-478.
18. Mac Faddin JF. Biochemical tests for identification of medical bacteria. Williams & Wilkins Co.; 1976.
19. Forbes BA, Sahm DF,Weissfeld AS. Bailey &Scott`s diagnostic microbiology. 12th ed. Missouri: Mosby Co; 2007: 323-333.
20. Michalska AD, Sacha PT, Kaczyńska K, Tryniszewska EA. The diversity of aminoglycoside-modifying enzymes among ESBL-positive proteus mirabilis clinical strains. Medtube Science. 2014;4(16):16-20.
21. Bartlett JMS, Stirling D. PCR Protocols: Methods in Molecular Biology. 1998. 2nd. Humana Press Inc. Totowa. NJ.
22. Ogunshe AA, Kolajo TT. In vitro phenotypic antibiotic resistance in bacterial flora of some indigenous orally consumed herbal medications in Nigeria. Journal of Rural and Tropical Public Health. 2006;5:9-15.
23. CLSI , clinical and laboratory standards institute.Performance standards for antimicrobial susceptibility testing.20th informational supplement.M 100-S22.,Wayne,2012 Pa; 32 (3).
24. Al-Bassam WW, Al- Kazaz A. The isolation and Characterization of Proteus mirabilis from different clinical Samples. J. of Biotechnology Research center 2013.7 (2).
25. Gangoue-Pieboji J, Koulla-Shiro S, Ngassam P, Adiogo D, Ndumbe P. Antimicrobial activity against gram negative bacilli from Yaounde Central Hospital, Cameroon. African health sciences. 2006;6(4).
26. Bahashwan SA, El Shafey HM. Antimicrobial resistance patterns of Proteus isolates from clinical specimens. European Scientific Journal, ESJ. 2013 Sep 30; 9(27).
27. Luzzaro F, Lombardi G, Perilli M, Belloni R, Amicosante G, Toniolo A. Antimicrobial Susceptibility Testing and ESBL Production in Clinical Isolates of Proteus Mirabilis: An Evaluation with the Phoenix™ Automated Microbiology System.
28. Al-Azawy AN, Al-Taai HRR, Al-Rajab IAM. Biological study of Proteus mirabilis isolated from different clinical sources in AL-Mqdadia city. Diyala J. for pure sci., 2015.11(2):42-60.
29. Winokur PL, Canton R, Casellas JM, Legakis N. Variations in the prevalence of strains expressing an extended-spectrum β-lactamase phenotype and characterization of isolates from Europe, the Americas, and the Western Pacific region. Clinical Infectious Diseases. 2001 May 15;32(Supplement_2):S94-103.
30. AL-Mousawi BKS. Isolation and diagnosis of some Gram-negative bacteria from surgical wound wounds and study of the antibiotic effect of the antibiotic (genetic study). Master Thesis. 2000. College of Science. Mustansiriya University. Iraq.
31. Makled A, Alghamdi A. Surveillance of aminoglycosides resistance among Proteus mirabilis isolates from different units in Jeddah Hospitals, Saudi Arabia. Egypt. J. Med. Microbiol. 2006 Apr;15(2):33.
32. Salman AR. Virulence of Certain Proteus species Isolated FromOtitis Media in Baquba and It`s Peripheries. Thesis. 2008. Diyala University.
33. Vakulenko SB, Mobashery S. Versatility of aminoglycosides and prospects for their future. Clinical microbiology reviews. 2003 Jul 1;16(3):430-50.
34. Hauschild T, Sacha P, Wieczorek P, Zalewska M, Kaczyńska K, Tryniszewska E. Aminoglycosides resistance in clinical isolates of Staphylococcus aureus from a University Hospital in Bialystok, Poland. Folia Histochemica et Cytobiologica. 2008;46(2):225-8.
35. Livermore DM, Winstanley TG, Shannon KP. Interpretative reading: recognizing the unusual and inferring resistance mechanisms from resistance phenotypes. Journal of Antimicrobial Chemotherapy. 2001 Jul 1;48(suppl 1):87-102.
36. Tolmasky ME. Bacterial resistance to aminoglycosides and beta-lactams: the tn1331 tn1331 transposon paradigm. frontiers in bioscience. 2000 Jan 1;5:d20-29.
37. Michalska AD, Sacha PT, Kaczyńska K, Tryniszewska EA. The diversity of aminoglycoside-modifying enzymes among ESBL-positive proteus mirabilis clinical strains. Medtube Science. 2014;4(16):16-20.
38. Dubois V, Arpin C, Dupart V, Scavelli A, Coulange L, André C, Fischer I, Grobost F, Brochet JP, Lagrange I, Dutilh B. β-Lactam and aminoglycoside resistance rates and mechanisms among Pseudomonas aeruginosa in French general practice (community and private healthcare centres). Journal of antimicrobial chemotherapy. 2008 May 8;62(2):316-23.
39. Haldorsen BC. Aminoglycoside resistance in clinical Gram-negative isolates from Norway [thesis]. North Norway (NO): University of Tromsø. 2011.
40. Wieczorek P, Sacha P, Hauschild T, Ostas A, Kłosowska W, Ratajczak J, Tryniszewska E. The aac (6') Ib gene in Proteus mirabilis strains resistant to aminoglycosides. Folia histochemica et cytobiologica. 2008;46(4):531-3.
41. Michalska AD, Sacha PT, Ojdana D, Wieczorek A, Tryniszewska E. Prevalence of resistance to aminoglycosides and fluoroquinolones among Pseudomonas aeruginosa strains in a University Hospital in Northeastern Poland. Brazilian Journal of Microbiology. 2014 Dec;45(4):1455-8.
Received on 04.10.2017 Modified on 26.10.2017
Accepted on 24.11.2017 © RJPT All right reserved
Research J. Pharm. and Tech 2018; 11(7): 2809-2813.
DOI: 10.5958/0974-360X.2018.00518.8