Comparison of methods used in identification of Candida albicans

 

Ashraf A. Kadry¹, Amira M. El-Ganiny¹, Ahmed M. El-Baz ²*

¹Department of Microbiology and Immunology, Faculty of Pharmacy, Zagazig University, Zagazig Egypt.

²Department of Microbiology and Biotechnology, Faculty of Pharmacy, Delta University for Science and Technology, Gamasa, Mansoura  Egypt.

 

ABSTRACT:

Candida species is a major fungal pathogen in humans. Candidal infections represent the fourth most common nosocomial infection worldwide. In other hand, systemic Canadidal infections have high morbidity and mortality rates, especially in case of non-appropriate treatments. Since, Candida albicans represent the most common species that cause Candidal infections, accurate identification of Candida albicans from other species has critical importance due to the differences in antifungal susceptibility profiles. The aim of this study was to evaluate and compare some standard phenotypic and genotypic techniques in identification of C. albicans isolates. The specimens were collected from seventy five patients diagnosed with respiratory tract infection, urinary tract infection, or Candidemia. The colonies of Candida were subjected to specific identification by germ tube test, growth on chromogenic agar and also using polymerase chain reaction (PCR). Fifty three isolates were identified as C. albicans by taking the PCR as standard technique in comparison to germ tube test which gives positive result with only 84.1%  of the strains, while the chromogenic agar give the green colonies with 96.3% of C. albicans isolates. These results suggest that the PCR is more sensitive and rapid than phenotypic techniques represented by germ tube and chromogenic agar for discrimination of C. albicans from other Candida species.

 

 

INTRODUCTION:

Candida albicans is a major human fungal pathogen. It has the ability to cause different mucosal infections in healthy individuals, as well as life-threatening systemic infections in immune compromised patients¹. Candida may involve any organ system and candidemia has diverse clinical picture, ranging from low-grade fever to fulminant septic shock. There are no characteristic signs and symptoms in disseminated candidiasis². Candida spp. account for 70-80% of fungal bloodstream infections, and collectively represent the fourth most common group of pathogens responsible for nosocomial bloodstream infection³. C. albicans is one of the most well-known causative agents of bloodstream infections in cancer patients⁴. Neutropenia is prevalently documented as vital risk factor for systemic candidiasis development ⁵.

 

It can be resulted from specific kinds of blood cancers or cancers infiltrating the bone marrow and is a well-known disadvantage of classical chemotherapy ⁶. Renal failure, corticosteroids therapy ⁴ and mechanical ventilation ⁷ are other risk factors for fungal infections that prevalently exist in cancers individuals. Candidemia is associated with high mortality rates of approximately 50%, especially when the antifungal treatment is not immediate or adequate ⁸. The identification of Candida to the species level is necessary in order to help in selecting the appropriate antifungal agent for the treatment of serious infections caused by Candida⁹.

 

It is worthy; to know the advantages and limitations of methods to choose the best method for diagnosis of candida infections at species level. The germ tube detection is often used to exclude C. albicans before applying other yeast species level identification schemes. However, up to 5% of the C. albicans isolates have been reported as germ tube negative¹⁰, and non-C. albicans isolates can be misinterpreted as germ tube positive.^10,11

 

Identification of Candida species also depends on morphological features on culture media such as Chromogenic agar¹². The routine classical methods used for identification of Candida albicans such as germ tube and chromogenic culture characteristics take up many days¹³. Therefore, these traditional methods are not appropriate for rapid, accurate and reliable identification.

This study aims to compare the identification of Candida albicans by phenotypic methods including germ tube and growth on chromogenic agar and genotypic technique such as Polymerase Chain Reaction (PCR).

 

MATERIALS AND METHODS:

Yeast isolates:

All the clinical specimens were collected under ethical standards from different Departments at Mansoura University Hospitals, and identified as described previously¹⁴. Briefly, the specimens were inoculated on Sabouraud dextrose agar (SDA) plates and incubated at 37 °C for 24-48 hours, and then the colonies were examined and subjected for further identification. The suspected colonies of C. albicans were examined for their colonial morphology, Gram staining, germ tube formation and culture characteristics on Candida chromogenic agar (Pronadisa Co., Madrid, Spain).The standard strain Candida albicans ATCC 10231was used as positive control in all tests.

 

Methods of identification:

1.      Germ tube method:

A small portion of well isolated colony of candida was suspended in 0.5 ml of human serumin eppendorf tube; the tube was incubated at 35ᵒC for 2 hours. A drop of the candida serum suspension was placed on a slide, overlaid with a cover-slip and examined microscopically at 30 minute intervals up to 2 hours for the presence of germ tubes which appear as cylindrical filaments originating from the blastospore, without any constriction of the length of the filaments ¹⁴.

 

2.      Subculture on Candida chromogenic agar medium:

Colonies that proved microscopically as yeast were subcultured on Candida Chromogenic agar incubated aerobically at 30ᵒC and inspected after 24-72 hours, and then colony color was recorded and interpreted according to manufacture instructions as presented in table 1 and Figure 1.

 

Table 1.Identification of different Candida species on chromogenic agar

 

Identification of Candida albicans isolates by PCR:

DNA of Candida albicans was extracted by colony PCR method¹⁵. Briefly, a pure colony of Candida albicans was picked up from SDA and inoculated into 30 ml TE buffer. The mixture was heated at 100ᵒC in water bath for 10 min, and then heated for 2 min in microwave at high power. Then centrifuged at 10000 rpm for 2 min and the supernatant were transferred to fresh eppendorf tube. The primers used for identification of C. albicans were purchased from Operon Biotechnologies GmbH Biocompus cologne, Germany, and have the following sequences (F) TTCTTTTCCTCCGCTTATTG and (R) AGCTGCCGCCAGAGGTCTAA¹⁶.

 

The target DNA were amplified in a 25 ml reaction mixture containing 2.5 ml DNA samples, 12.5 ml my Taq red mix (Bioline Co., UK), 1ml of each forward (F) and reverse (R) primers (10mM), and nuclease free water up to 25 µl. the cycling condition include heating at 95 °C for 3 min, then 30 cycles of 94 ᵒC for 60 seconds, 52 ᵒC for 30 seconds and 65 °C for 45seconds and finally heating at 65°C for 7min. The PCR products as well as 100 base pair molecular DNA markers (Bioline Co., UK) were separated on 1.5% agarose gel, stained with ethidium bromide, visualized by UV transilluminator and photographed.

 

RESULTS:

1.      Identification of Candida albicans isolates:

Fifty three non-duplicate Candida albicans clinical isolates were identified in the present study. The number and source of Candida albicans and non albicans were given in table (2).Out of 75 isolates, 53 (70.7%) were C. albicans, and 22 (29.3%) were Candida non-albicans as shown in Table 3 and Fig. 1.

 

Table 2.The number and source of Candida albicans and non albicans isolates

Source	Candida isolates	Candida albicans isolates
Blood	16	6
Respiratory	37	30
Urinary tract	22	17
Total	75	53

                             

Table 3 represents results of phenotypic and genotypic identification of each Candida isolate. Among all Candida isolates, 48 isolates were germ tube positive, and 27 were germ tube negative. On Chromogenic agar, 51 isolates gave green colonies of Candida albicans on Chromogenic agar, 6 gave pink colonies of C. krusie, one gave blue colonies of C. tropicalis and 15 gave white creamy colonies (Fig 1). For PCR, 53 isolates gave a single band of of446 bp using C. albicans species specific primers (Fig. 2), Collectively, 8isolates of C. albicans were germ tube negative despite being positive in PCR identification in the other hand,3 isolates of non-albicans species were germ tube positive. Also two isolate did not give a green colony on Candida Chromogenic ager and were also positive by PCR.

Table 3.Identification of Candida species by different methods

Isolate No.	Source	Phenotypic identification		Genotypic identification	Result
		Germ tube	Chromogenic agar	PCR
ATCC 10231	Standard strain	+ve	Green color	+	C. albicans
1	R	+ve	Green color	+	C. albicans
2	R	+ve	Green color	+	C. albicans
3	R	+ve	Green color	+	C. albicans
4	R	+ve	Green color	+	C. albicans
5	R	+ve	Green color	+	C. albicans
6	R	+ve	Green color	+	C. albicans
7	R	-ve	Darkblue color	- (NA)	C. tropicalis
8	R	-ve	White creamy color	- (NA)	Candida species
9	B	-ve	Pink color	- (NA)	C. krusei
10	B	-ve	Pink color	- (NA)	C. krusei
11	B	-ve	Pink color	- (NA)	C. krusei
12	R	+ve	Green color	+	C. albicans
13	R	-ve	White creamy color	- (NA)	Candida species
14	R	+ve	Green color	+	C. albicans
15	R	+ve	Green color	+	C. albicans
16	R	-ve	Pink color	- (NA)	C. krusei
17	R	+ve	Green color	+	C. albicans
18	B	-ve	White creamy color	- (NA)	Candida species
19	B	+ve	Pink color	- (NA)	C. krusei
20	B	+ve	Green color	+	C. albicans
21	R	+ve	Green color	+	C. albicans
22	R	+ve	Green color	+	C. albicans
23	R	+ve	Green color	+	C. albicans
24	B	-ve	White creamy color	- (NA)	Candida species
25	R	+ve	Green color	+	C.albicans
26	R	+ve	Green color	+	C.albicans
27	R	+ve	White creamy color	- (NA)	Candida species
28	R	+ve	Green color	+	C.albicans
29	R	+ve	Green color	+	C.albicans
30	R	+ve	Green color	+	C.albicans
31	R	+ve	Green color	+	C.albicans
32	B	+ve	Green color	+	C.albicans
33	R	+ve	Green color	+	C.albicans
34	R	+ve	Green color	+	C.albicans
35	B	+ve	Green color	+	C.albicans
36	R	+ve	Green color	+	C.albicans
37	R	+ve	Green color	+	C.albicans
38	R	+ve	Green color	+	C.albicans
39	B	+ve	White creamy color	- (NA)	Candida species
40	R	+ve	Green color	+	C.albicans
41	R	+ve	Green color	+	C.albicans
42	B	-ve	White creamy color	- (NA)	Candida species
43	B	+ve	Green color	+	C.albicans
44	R	+ve	Green color	+	C.albicans
45	R	+ve	Green color	+	C.albicans
46	R	+ve	Green color	+	C.albicans
47	R	+ve	Green color	+	C.albicans
48	R	-ve	White creamy	- (NA)	Candida species
49	B	-ve	White creamy	- (NA)	Candida species
50	B	+ve	Green color	+	C. albicans
51	B	-ve	White color	- (NA)	Candida species
52	R	-ve	White creamy color	- (NA)	Candida species
53	B	+ve	Green color	+	C.albicans
54	U	+ve	Green color	+	C. albicans
55	U	-ve	Green color	+	C. albicans
56	U	+ve	Green color	+	C. albicans
57	U	-ve	Green color	+	C. albicans
58	U	+ve	Green color	+	C. albicans
59	U	-ve	White creamy	- (NA)	Candida species
60	U	-ve	White creamy	- (NA)	Candida species
61	U	-ve	White creamy	+	C. albicans
62	U	-ve	Green color	+	C. albicans
63	U	-ve	White creamy	+	C. albicans
64	U	+ve	Green color	+	C. albicans
65	U	-ve	Green color	+	C. albicans
66	U	+ve	Green color	+	C. albicans
67	U	+ve	Green color	+	C. albicans
68	U	+ve	Green color	+	C. albicans
69	U	+ve	Green color	+	C. albicans
70	U	+ve	Green color	+	C. albicans
71	U	-ve	Green color	+	C. albicans
72	U	-ve	Pink color	- (NA)	C. Krusei
73	U	-ve	Green color	+	C.albicans
74	U	-ve	White creamy color	- (NA)	Candida species
75	U	-ve	White creamy color	- (NA)	Candida species

R= respiratory infection    - B= Blood infection    - U = Urinary infection - NA = Non-albicans species

 

Fig. 1: Chromogenic agar with different species of Candida (A: C. albicans, B: C. krusei, C: C. tropicalis, D: other Candida spp)

 

Fig. 2: Electrophoresisgraph of PCR products for identification of some C. albicans isolates.

Lane 1 (M): represent 100 bp DNA ladder, Lane 2 (-C): negative control, Lane 3 (+C): positive control (standard strain ATCC 10231), Lane 4 to lane 9: C. albicans isolates, Lane 10 to lane 14: Non albicans Candida.

 

DISCUSSION:

Systemic C. albicans infections remain the most common fungal infection among all Candidal species ¹⁷.Precise identification of Candida to the species level is particularly essential due to the emergence of new pathogenic species and because of the different antifungal susceptibility profiles of these species¹⁸.The rapid and accurate identification of C. albicans from other species, such as C. krusei or C. glabrata which are intrinsically azole-resistant, represent a leading goal of microbiology laboratories especially for critically ill patients¹⁹.

 

The current study was designed to compare the identification of clinical isolates of C. albicans by the traditional phenotypic methods and the advanced genotypic method; PCR. The isolates were associated with systemic infections in a group of 75 patients with Candidal infections of urinary tract infection, respiratory infections or candidemia. Despite, the germ tube test is the gold standard of laboratories for the identification of C. albicans²⁰. Appearance of germ tube was not adequate for the identification of all C. albicans in the current study; since 15.1% of the isolates were germ tube negative despite being positive in the other tests and only 84.9% could be identified by germ tube. Mean while, William and lewis^]21[ reported that 95% of C. albicans isolates were germ tube positive.

 

On the other hand, Chromogenic media were economic and simple to use. Their main limitations were the lower discrimination power between all Candida species. In addition, the color of Candida colonies on chromogenic media may vary especially after storage and subculture, as demonstrated previously for C. dubliniensis²². In our study the chromogenic media give sensitivity in identification of C. albicans up to 96.3% which was consistent with the results reported by Daef et al ²³in Egypt, which revealed 97.5% sensitivity in identification of Candida species. Meanwhile, another Egyptian study done by El Feky et al²⁴ reported a lower sensitivity reached up to 90.5%.

 

Obviously, the genotyping by PCR method revealed 100% sensitivity in detection of Candida albicans isolates which was in agreement with results reported by Daef et al ²³.

 

Current study shows that C. albicans isolates remain the most prevalent (70.6%) species in systemic infections, which was in accordance with that reported by Krcmery and Barnes²⁵; and Fleck et al. ²⁶. Non-albicans Candida levels are in agree with the values in the literature that denote the epidemiological shift of Candida pathogens perceived in the last decade’s^{27, 28}.

 

CONCLUSION:

The study showed that C. albicans isolates were the most common Candida species present in systemic candida infections. Identification by PCR showed maximal sensitivity, as well as it is easy, rapid, reliable and applicable in clinical laboratory for identification of the medically important Candida albicans isolates in comparison with other phenotypic techniques such as germ tube and chromogenic agar.

 

CONFLICT OF INTEREST:

There is no conflict of interest.

 

REFERENCES:

1.       Odds FC. Candida and Candidosis, 2ed edition. A review and Bibliography, London: Bailliere Tindall. 1988.

2.       Fidel PL, Vazquez JA, and Sobel JD. Candida glabrata review of epidemiology, pathogenesis and clinical diseases with comparison to Candida albicans. Mycopathologia. 1999, 91:3-15.

3.       Trick Wet al. Secular trend of hospital-acquired candidemia among intensive care unit patients in the United States during 1989–1999. Clinical infectious Disease. 2002, 35:627–630.

4.       Teoh F and Pavelka N. How chemotherapy increases the risk of systemic candidiasis in cancer patients: current paradigm and future directions. Pathogens.2016, 5(1): 6; doi: 10. 3390.

5.       Pfaller M A et al. Multicenter comparison of the VITEK 2 antifungal susceptibility test with the CLSI broth microdilution reference method for testing amphotericin B, flucytosine, and voriconazole against Candida spp. Journal of Clinical Microbiology. 2007, 45: 3522–3528.

6.       Weinzierl EP and Arber DA. The differential diagnosis and bone marrow evaluation of new-onset pancytopenia. American Journal of Clinical Pathology. 2013, 139: 9–29.

7.       Soares M, Depuydt PO, and Salluh JI. Mechanical ventilation in cancer patients: Clinical characteristics and outcomes. Critical Care Clinics. 2010, 26: 41–58.

8.       Posteraro B et al. Early diagnosis of candidemia in intensive care unit patients with sepsis: a prospective comparison of (1à3)-b-D-glucan assay, Candida score, and colonization index. Critical Care. 2011, 15 (5):R249.

9.       Eraso E et al. Evaluation of the new chromogenic medium Candida ID 2 for isolation and identification of Candida albicans and other medically important Candida species. Journal of Clinical Microbiology. 2006, 44:3340-3345.

10.     Salkin IF et al. Evaluation of YestIdent and Uni-Yeast-Tek yeast identification systems. Journal of clinical microbiology. 1987, 25:625–627.

11.     Jabra-Rizk MA et al. Prevalence of Candida dubliniensis fungemia at a large teaching hospital. Clinical Infectious Disease. 2005, 41:1064–1067.

12.     Okungbowa FI, Dede AP and Isikhuemhen OS. “Cellmorphology variations and budding patterns in Candida isolates,” Advances in Natural and Applied Sciences.2009, 3(2):192–195.

13.     Maaroufi Yet al. Early detection and identification of commonly encountered Candida species from simulated blood cultures by using a real-time PCR-based assay. Journal of Molecular Diagnostics. 2004, 6:108-114.

14.     Cheesbrough M. Microbiological Tests. In: Cheesbrough, M., Ed., District Laboratory Practice in Tropical Countries, Part II, Low Priced Edition, Cambridge University Press, Cambridge, 2000, 2^nded:pp105-130.

15.     Marinho SA et al. Identification of Candida spp. by phenotypic tests and PCR. Brazilian Journal of Microbiology. 2010, 41: 286-294 ISSN 1517-8382.

16.     Carvalho A et al. Multiplex PCR identification of eight clinically relevant Candida species. Medical Mycology. 2007, 45(2): 619-627.

17.     Souza M et al. Comparison between four usual methods of identification of Candida species. Rev. Inst. Med. Trop. Sao Paulo. 2015, 57(4):281-287.

18.      Wei Y, Feng J, and Luo Z. Isolation and genotyping of vaginal non albicans Candida spp. in women from two different ethnic groupsin Lanzhou China. International Journal of Gynecology and obstetrics. 2010, 110:227–230.

19.     Chen SC, Halliday CL, and Meyer W. A review of nucleic acid based diagnostic tests for systemic mycoses with an emphasis on polymerase chain reaction-based assays. Medical Mycology. 2002, 40:333-357.

20.     Byadarahally RS and Rajappa S. Isolation and identification of Candida from the oral cavity. ISRN Dentistry. 2011;487921.

21.     Williams DW and Lewis MA. Isolation and identification of Candida from oral cavity. Oral diseases. 2000, 6:3-11.

22.     Momani, OM and Qaddoomi A. Identification of Candida dubliniensis in a diagnostic microbiology laboratory. East Mediterranean Health Journal. 2005, 11:366-371.

23.     Daef E et al. Evaluation of chromogenic media and semi-nested PCR in the identification of Candida species. Brazilian Journal of Microbiology.2014, 45(1): 255-262.

24.     ElFeky D et al. Species identification and antifungal susceptibility pattern of Candida isolates in cases of vulvo vaginal candidiasis. Alexandria Journal of Medicine. 2016, 52: 269–277.

25.     Krcmery V and Barnes AJ. Non-albicans Candida spp. causing fungaemia: pathogenicity and antifungal resistance. Journal of Hospital Infection. 2002, 50:243–260

26.     Fleck R, Dietz A, and Hof H. In vitro susceptibility of Candida species to five antifungal agents in a German university hospital assessed by the reference broth microdilution method and E-test. Journal of Antimicrobial Chemotherapy. 2007, 59:767–771.

27.     Hazen KC. New and emerging yeast pathogens. Clinical Microbiology Reviews.1995, 8:462–478

28.     Jarvis WR. Epidemiology of nosocomial fungal infections, with emphasis on Candida species. Clinical Infectious Disease.1995, 20:1526–1530.

 

 

 

 

 

Received on 26.10.2017         Modified on 24.11.2017

Accepted on 06.12.2017      © RJPT All right reserved