Growth Hormone Receptor and Histopathological Study in Patients with Tonsillitis

 

Nuha SH. Ali

Department of Basic Sciences, College of Dentistry, University of Al-Qadisiyah, Diwaniyah, Iraq.

 

ABSTRACT:

The goal of the present study was to investigate the relationship between tonsillitis and growth factor in children by determining the gene expression of growth hormone receptor (GHR) in tonsils using real-time PCR (RT-PCR) as well as investigating the histopathological changes that are induced by tonsillitis.The study was done viataking samples from extirpated tonsils of 20 children which are divided according to the age into two groups, under and older than 10 years old.Thesamples-based mRNA was subjected to RT-PCR technique to target the GHR gene. The samples were further examined to explore the histopathological changes using tissue sectioning. The study results indicatedthat the GHR-gene expression in the children of less than 10 years of old was 10.546 for females and 6.150 for males, while it was 2.129 for femalesand 4.081 for males of older than 10 years of old. The histopathological changes revealed necrosis, erosion, hyperplasia, aggregation of collagenous fibers, and the presence of lobulated tonsils. These results show evidence that the activity of the GHR gene in female patients, less than 10 years of old, is higher than that in male patients, while it is higher in male than female patients of older than 10 years of old.

 

 

 

INTRODUCTION:

Tonsils are tissue sets that are present on both sides of the throat, and their function is to develop immunity processes until the age of two years. Tonsils also remove bacteria and viruses that get in respiratory airway. They form antibodies to help kill infections.Removing tonsils will prevent improvement person’s ability to fight infections (1). Tonsillitis means inflammation of tissue of the pharyngeal tonsils. The inflammation may invade other tissues that are located behindthe throat such as adenoidand lingual tissues. The symptoms include sore throat, fever, tonsils become enlarged, difficult swallowing, and lymph nodes become largerthan normal size. The inflammation could also result in complications such as abscess formation (2). In untreated pediatric patients,consequences of disordered breathing such as snoring, sleeping disorders, and imbalanced mood and inattentive could be developed.

 

The growth hormone (GH)is secreted at night during sleep time. Decreased levelsof secreted GH may lead to reduce food intake and thus slow down growth rate (3-5). GH is a protein-based hormone that is released from lobes of pituitary gland (6,7). It is also responsible for stimulating of growth, and it playsa great role in the immune system (8). GH works by binding to a specific target, high affinity of cell surface protein, and that isthe growth hormone receptor (GHR) (9). It also directs several types of tissues such as bones, liver, and tonsils to perform several functions like elongation, improvement of digestion, and immune-response promotion respectively (10). The GHR is a cytokine-hemoprotein-based receptor (11,12). Once the GH binds to its receptor, processes of signaling cascades are activated leading to subsequent transcription of certain genes in that particular cell (13-15).

 

There is a strong relationship between tonsillitis and decreasing growth that has been seen for many years in children. The clinicians recorded this problem anddramatic transformation that sometimesoccurred after tonsillectomy (16,17). Some studies suggest links with upper airway obstruction, suppression of appetite, and long term oropharyngeal infection may also play a great role for decreasing growth in connection to GH action in developing immune system (18-23).Also others studies have revealed connections between the immune and the neuroendocrine system (24-26). No doubt that the GH can influence immune function because it affects several immune system components such as thymus, spleen, tonsil, lymph nodes, thymoma, lymphomas, and normal T and B lymphocytes.It also influences liver, muscles, adipose tissue, the regulation of metabolism, post-natal growth, immunity, cardiac and renal systems, and gut functions (27-31).

 

Gene expression is the process in which gene activity is seen via the ability of that particular gene to code for a product in a cell such as a specific protein. GHR-gene expression is also regulated by factors such as nutrition, growth hormone, other steroid hormones, and some diseases such as diabetes mellitus (32-36).To the best of our knowledge, this is the first tonsil-sample-based study in world and Iraq that aimed to investigate the effects of tonsillitis on GHR-gene expressionand to explore any variations in this expression in males and females of under and older than 10 years of old.

 

MATERIALS AND METHODS:

Ethics and patient's specimens

The samples were taken only from extirpated tonsils after tonsillectomy. Extirpated-tonsil sampleswere collected from patients with tonsillitis after tonsillectomy, 9 children under 10 years of old and 9 children older than 10 years of old, from Al-DiwaniyahTeaching Hospital, Al-Diwaniyah, Iraq and were placed in sterile-collection tubes preloaded with diethyl pyrocarbonate(DEPC). Then, the samples were transported to a laboratory and stored in a deep freezer.

 

Total RNA extraction:

Total RNA were extracted from tonsil tissue using Accuzol^® reagent kit (Bioneer,South Korea) and were done according to the company instructions as follow; 100mg of tonsil tissue was placed in a sterile 1.5ml Eppendorf tube, and 1 ml of Accuzol reagent was added. Then, the tissues were homogenized using a micropestle.After that, the tubes were shaken vigorously for a minute. Later, 200μl chloroform was added to each tube and shaken vigorously for 15 seconds. Then,a 5min-incubation period in ice was performed that was followed by a 4̊C-centrifugationprocess at 12000rpm for 15 minutes. The supernatant was transferred into a new Eppendorf tube, and 500μl isopropanol was added. Then, the contentswere well-mixed via inverting the tube 4-5 times. An incubated period at 4 ̊C for 10 minutes was followed. Then, a 4̊C-centrifugation process at 12000 rpm for 10 minutes was done. After the supernatant was discarded, 1ml of 80%ethanol was added followed by vortexing. Then, a 4̊C-centrifugation process at 12000 rpm for 5 minutes was completed. The RNA pellet was exposed to an air-dry process after the supernatant was discarded. Finally, a dissolving process of this pellet was performed by adding 50μl of DEPC to be later stored at -20 ̊C. A NanoDrop spectrophotometer (THERMO, USA) was used to evaluate the resulted RNA for quality and quantity purposes. DNase I enzyme was applied to the extracted RNA using DNase I enzyme kit^® (Promega Company, USA) and following the manufacturer’s protocol.

 

Synthesis of cDNA:

AccuPower® RocktScript RT PreMix Kit (Bioneer Company, South Korea)was used to convert RNA into cDNA and following the manufacturer’s protocol. Briefly, mastermix containing 10µl of 100ng/µl RNA, 1µl of 10pmol random hexamer primer, and 9µl DEPC water was prepared. Then, the mix was placed in specific tubes provided with the kit that contained lyophilized reverse transcriptase enzyme and was followed by short periods of vortexing and spinning down. A thermocycler was utilized to perform the reaction process using conditions of 50 ̊C for 1 hr of cDNA synthesis (RT step) and 95 ̊C for 5 min of heat deactivation.

 

Real-time PCR:

RT-PCR was performed to quantify the mRNA transcript levels of GHR. A relative gene expression analysis was carried out using 2^-∆∆CT Livak Method (1). The RT-PCR reaction was done using a Real-Time PCR system (BioRad, USA), and SYBER Green dye qPCR master mix was utilized to detect the amplification of the target gene and b-actin, a housekeeping gene for normalizing the results. Primers were designed using the primer3 plus website, and they are F: TTTAGTGCGTGCAGATGGTG and R: GCAAAACCAAGTTGGGTGTG for the GHR gene and F: TCGTGCGTGACATTAAGGAG and R: TTGCCAATGGTGATGACCTG for the b-actin gene. The product sizes are 77bp for the GHR gene and 133bp for the b-actin gene. These primers are found in the NCBI Websites under the numbers, NM_001242406.2 and NM_001101.3 respectively. RT-PCR mastermix was prepared for GHR-target gene and the b-actin gene according to AccuPowerTM 2XGreen Star qPCR master mix kit® (Bioneer Company, South Korea). The mastermix contained 5µl of 10ng cDNA, 2µL of 10pmol from each primer, 25µL of 2X green star master mix, and 16µl of DEPC water. Then, the mix was placed in RT-PCR strips. After that, the strips were briefly vortexed and centrifuged for 3 minutes. Then, the strips were placed in Miniopticon Real-Time PCR System (BioRad, USA) under the following thermocycler conditions of 1 cycle of initial denaturation at 50 ̊C for 1min, 40 cycles of denaturation and annealing/extension detection (scan) at 95 ̊C for 20s and 60 ̊C for 30s respectively, and 1 cycle of melting at 60-95 ̊Cfor 0.5s.

 

 

 

 

 

RESULTS:

The results showed expressing high levels of GHR gene in the tonsillitis-patient children of under 10 years of old especially in females more than that in males. The value of fold changes in in those children was 10.546 for females and6.150 for males as shown in (Table 1) and (Figure 1).

 

Table 1: The relative gene expression analysis of growth hormone receptor (GHR) genein tonsillitis-patient childrenof under 10 years of old by the^2-∆∆CT Livak Method.Fold change is a measure describinghow much a quantity changes going from an initial to a final value.

Group	CT		ΔCT	Fold change expression	Fold change Mean±SE
	(GHR)	(B-actin)
Males	30.54	33.31	2.78	6.84	6.150±0.976
	31.12	33.47	2.35	5.10
	30.45	33.54	3.10	8.54
	31.30	33.34	2.04	4.11
Females	29.73	33.15	3.42	10.68	10.546±0.438
	29.93	33.53	3.60	12.12
	29.33	32.61	3.28	9.73
	30.43	33.71	3.28	9.72
	29.79	33.18	3.39	10.48

 

 

Figure 1:Growth hormone receptor (GHR)-mRNA expression in tonsillitis-patient children of less than 10 years of old. Bars display the mean and the standard error (Mean±SE). Significant values are at p<0.05.

While the results of the expression levels in the tonsillitis-patient children of older than 10 years of oldrevealed little expression when compared with the younger ages with high expression in the males than female.Fold change values were 4.081 for males and 2.129 for females as shown in (table 2) and (figure 2).

 

Figure 2: Growth hormone receptor (GHR)-mRNA expression in tonsillitis-patient children of older than 10 years of old. Bars display the mean and the standard error (Mean±SE). Significant values are at p<0.05.

 

 

 

 

Table 2: The relative gene expression analysis of growth hormone receptor (GHR) gene of the tonsillitis-patient children of older than 10 years of old by the ^2-∆∆CT Livak Method.

Group	CT		ΔCT	Fold change expression	Fold change Mean±SE
	(GHR)	(B-actin)
Males	31.25	33.39	2.14	4.41	4.081±0.521
	31.14	33.21	2.08	4.22
	32.24	33.63	1.39	2.62
	31.17	33.51	2.35	5.08
Females	32.18	33.41	1.24	2.35	2.129±0.153
	32.59	33.55	0.95	1.94
	32.32	33.59	1.27	2.41
	32.54	33.23	0.69	1.61
	32.23	33.45	1.22	2.33

 

Histopathologically,figure 3, A and B, includes all the changes that occurred in the tissues of the sampled tonsils such asnecrosis, erosion, and hyperplasia. While figure 4 shows several changes in this tissue such as aggregation of collagenous fibers and the presence of lobulated tonsils.

 

 

Figure 3: The Histopathological sections of tonsils. A. necrosis, erosion, hyperplasia and lymphoid follicles. B. There is some hyperplasia with extreme clearness of germinal center. 200X (H&E stain).

 

Figure 4: The Histopathological section of tonsils. A. Excessive collagenous fibers with conjunctive stroma. B. There are strong fascicles with clear division tendency into lobule formation. 200X (H&E stain).

 

DISCUSSION:

Tonsillitis is a serious health problem that applies challenges to the health of the children.Rapid detection of the inflammation etiologycan preventthe occurrence of complications such as growth failure, rheumatic fever, and dyspnea (37).The failure of growth in children is a riskyissue that is causedby several factors such as malnutrition, indigestion, malabsorption, and decrease or absent of GH and/or GHR that could be affected in some diseases such as tonsillitis (38).To the best of our knowledge, this is the first tonsil-sample-based study in world and Iraq that aimed to investigate the effects of tonsillitis on GHR-gene expression and to explore any variations in this expression in males and females of under and older than 10 years of old. In the case of children of less than 10 years of old, females showed higher expression of the GHR gene than that in males, and this agrees with (39,40). Levels of transcribed GHR gene are affected by psychological stress,and GH activity is related to body energy and body weight. However, GH needs GHR because GH is not a steroid hormone, and its main function is related to the signaling that is generated at the GHR point. Therefore,deficientof the GHR could affect the GH function to reduce GHR-based signaling. It may also show a decreasein the pituitary functions that causes a high risk of metabolic syndrome via insufficiency in the GH/GHR-based functions (41).

 

In the case of children of older than 10 years of old, males showed higher expression of the GHR gene than that in females, and this agrees with. The current study results agree with (42-46) who found decreases inthe growth of females more than that in males by measuring the heights of those children. Moreover, (47) incorporated infants and toddlers in their studyto evaluate them before and after tonsillectomy for height, weight, circulating highly sensitive C reactive protein and found that surgery not only decreased inflammation but also stimulated growth in those patients (48). In addition, (49-51) found significantly low levels of GHR-gene mRNA in different tissues in obesity which resulted in decreased GHR availability. However, (52) revealed different results when measured height and weight to compare between groups that suffered from recurrent tonsillitis. They found that recurrent tonsillitishad no effect on delaying growth in children.

 

The current study results of the histopathological changes in tonsillitis showed necrosis, hyperplasia; enlargement of the lobes, and there are pus mixed with debris cells and collagenous fibers. These results agree with (53,54) who found hyperplasia and hypertrophy of the lymphoid follicles in the tonsils.In the current study, microhemorrhages and hematic extravasations were also noticed inside the follicles, and collagenous-fiber enrichment was shown in the conjunctive stroma.Previously, chronic tonsillitis, follicular tonsillitis, chronic suppurative tonsillitis, lymphoid hyperplasia, and lymphoma were observed (55). Collagenous fibers and hypertrophied-germinative clear-center in the tonsilar follicle were seen. Moreover, Tonsillar crypt had dead-cell remains and lymphocytes in the lumen. These literatures agree with the current study results. Hypertrophy of tonsil and adenoid may be caused by recurrent tonsillitis and upper airway obstruction in children. A reduced dietary intake and failure to gain weight are frequently reported by parents of children with a history of recurrent acute tonsillitis and adenotonsillar hypertrophy (56).

 

ACKNOWLEDGEMENT:

The author would like to thank University of Al-Qadisiyah, Diwaniyah, Iraq.

 

 

 

 

REFERENCES:

1.       Brooks AJ, Waters MJ. The growth hormone receptor: mechanism of activation and clinical implications. Nat. Rev. Endocrinal 2010; 515–525.

2.       Klug, TE; Rusan, M; Fuursted, K; Ovesen, T. Peritonsillar Abscess: Complication of Acute Tonsillitis or Weber's Glands Infection?. Otolaryngology--head and neck surgery: official journal of American Academy of Otolaryngology-Head and Neck Surgery. 155 (2);2016: 199–207. doi:10.1177/0194599816639551. PMID 27026737.

3.       Jump up^ Greenwood FC, Landon J. "Growth hormone secretion in response to stress in man". Nature. 210 (5035);1966: 540–1. doi:10.1038/210540a0. PMID 5960526.

4.       E.H. van den Akker, A.G. Schilder, Y.J. Kemps, F.A. van Balen, G.J. Hordijk, A.W. Hoes, Current indications for (adeno)- tonsillectomy in children: a survey in The Netherlands, Int. J. Pediatr. Otorhinolaryngol. 67 (6); 2003: 603—607.

5.       W. Richards, R.M. Ferdman, Prolonged morbidity due to delays in the diagnosis and treatment of obstructive sleep apnea in children, Clinical Pediatrics (Philadelphia) 39 (2); 2000: 103—108.

6.       Kelley, K. W.. Growth hormone in immunobiology. In Psychoneuroimmunology, 2nd Ed. R. Ader, D. L. Felton, and N. Cohen, eds. Academic Press, New York, 1991: p. 377.

7.       Murphy, W. J., R. Hallgeir, and D. L. Longo.. Effects of growth hormone and prolactin in immune development and function. Life Sci. 57:1; 1995.

8.       Clark, R.. The somatogenic hormones and insulin-like growth factor-1: stimulators of lymphopoiesis and immune function. Endocr. Rev. 18:157; 1997.

9.       Primus E. Mullis, Reinhard W. Hollb, Torben LundcvdA, ndree Eblta, Paul M. Brickelld Molecular and Cellular Endocrinology. Regulation of human growth hormone-binding protein production by human growth hormone in a hepatoma cell line. 18;.1995: 1-l 90.

10.     Shaonin Ji, Ran Guan, Stuart J. Frank, and Joseph L. Messina.. Insulin Inhibits Growth Hormone Signaling via the Growth Hormone Receptor. 274 (19); 1999: 13434–13442, U.S.A.

11.     Maj, A. and Zwierzchowski, L.. A LINE-1 element insertion in the 5-noncoding region of caprine growth hormone receptor gene. Biochemical Genetics. 43; 2005: 465-470.

12.     Moody, D. E.; Pomp, D.; Barendse, W. and Womack, J. E.: Assignment of the growth hormone receptor gene to bovine chromosome 20 using linkage analysis and somatic cell mapping. Animal Genetics. 26; 1995: 341-343.

13.     Frank, S. J: Growth hormone signaling and its regulation: preventing too much of a good thing. Growth Hormone & Research. 11; 2001: 201-212.

14.     Herrington, J. and Carter-Su, C. Signaling pathways activated by the growth hormone receptor. Trends in Endocrinology and Metabolism. 12; 2001: 252-257.

15.     Jiang, H. and Lucy, M. C. Variants of the 5-untranslated region of the bovine growth hormone receptor mRNA: isolation, expression, and effects on translational efficiency. Genetics. 265; 2001: 45-53.

16.     Bate, T.W.P. price, D.A. Hohne, C.A., and u&en. R.B., Short stature caused by obstructive sleep, Arch. Dis. Child. 59; 1984: 78-80.

17.     A Tmatise on Diseases of the Nose and, London, 1892, pp,

18.     Broillette, R.T. Fembach S.K. and Hunt C.E. Sleep apnoea in infants and children, J. pediatr.. 100; 1982: 31-40.

19.     Goldstein, SJ., Wu. R. .K., Thorpy.. M.J., Shprintzen R.S., Marion .E. ad Saenger P., Reversibility of deficient sleep entrained growth hormone secretion in a boy with acbondrop~~si~ and obstructivesleep apnoea, Acta Endocrinol. 116; 1987: 95-101.

20.     Schiffman, R., Faber, J. and Eidelman A.I., Obstructive hypertrophic adenoids of tonsils as a case of infantile failure to thrive: reversed by tonsillectomy and adenoidectomy. Int. J. Pediatr., Otorhinolaryngol. 9; 1985: 183-187.

21.     Smith, P. the effect of hypophysectomy upon the involution of the thymus in the rat. Anat. Rec. 47;1930: 119–143.

22.     Meazza C, Pagani S, Travaglino P & Bozzola M Effect of growth hormone (GH) on the immune system. Pediatr Endocrinol Rev 1 Suppl. 3; 2004: 490–495.

23.     E.H. van den Akker, A.G. Schilder, Y.J. Kemps, F.A. van Balen,

24.     G.J. Hordijk, A.W. Hoes, Current indications for (adeno)- tonsillectomy in children: a survey in The Netherlands, Int. J. Pediatr. Otorhinolaryngol. 67 (6); 2003: 603—607.

25.     W. Richards, R.M. Ferdman, Prolonged morbidity due to delays in the diagnosis and treatment of obstructive sleep apnea in children, Clinical Pediatrics (Philadelphia) 39 (2); 2000: 103—108.

26.     Gloria C. Koo, Christopher Huang, Ramon Camacho, Charlotte Trainor, J. Tom Blake, Anna Sirotina-Meisher, Klaus D. Schleim, Tsuei-Ju Wu, Kang Cheng, Ravi Nargund, and Gaylord McKissick. Immune Enhancing Effect of a Growth Hormone Secretagogue. The Journal of Immunology. 2017.

27.     D.A. Weigent, J.E. Blalock, Expression of growth hormone by lymphocytes, Int. Rev. Immunol. 4 (3);1989: 193–211.

28.     H. Wu, R. Devi, W.B. Malarkey, Localization of growth hormone messenger ribonucleic acid in the human immune system — a Clinical Research Center study, J. Clin. Endocrinol. Metab. 81 (3); 1996: 1278–1282.

29.     N. Hattori, T. Saito, T. Yagyu, B.H. Jiang, K. Kitagawa, C. Inagaki, GH, GH receptor, GH secretagogue receptor, and ghrelin expression in human T cells, B cells, and neutrophils, J. Clin. Endocrinol. Metab. 86 (9); 2001: 4284–4291.

30.     Michael J.Waters.The growth hormone receptor. Growth Hormone & IGF Research.Institute for Molecular Bioscience, University of Queensland, St. Lucia 4072, Australia, 28; 2015: 6–10.

31.     Jennifer E. Rowland, Agnieszka M. Lichanska, Linda M. Kerr, Mary White, Elisabetta M. d’Aniello, Sheryl L. Maher, Richard Brown, Rohan D. Teasdale, Peter G. Noakes, and Michael J. Waters.Molecular and cellular biology, 25 (10270); 2005: 66–77

32.     Brueckner F, Armache KJ, Cheung A, et al. "Structure–function studies of the RNA polymerase II elongation complex". Acta Crystallogr.D. 65 (Pt2):11220; 2009: doi:10.1107/S0907444908039875. PMC 2631633. PMID 19171965.

33.     Sirri V, Urcuqui-Inchima S, Roussel P, Hernandez-Verdun D. "Nucleolus: the fascinating nuclear body". Histochem. Cell Biol. 129 (1); 2008: 13–31. doi:10.1007/s00418-007-0359-6. PMC 2137947 .PMID 18046571.

34.     Mol Genet Metab. Regulation of growth hormone receptor gene expression. Schwartzbauer G1, Menon RK. 63(4); 1998:243-53.

35.     Diana Cristina Pérez-Ibave a, Iram Pablo Rodríguez-Sánchez a, María de Lourdes Garza-Rodríguez a, Hugo Alberto Barrera-Saldaña a,b, Extrapituitary growth hormone synthesis in humans a Department of Biochemistry and Molecular Medicine, School of Medicine, Autonomous University of Nuevo León, Monterrey 64630, Mexico b Vitaxentrum, Blvd. Puerta del Sol 1005, Colinas de San Jerónimo, Monterrey, Nuevo León, 64460 Mexico.

36.     Ranabir S, Reetu K. "Stress and hormones". Indian J Endocrinol Metab. 15 (1); 2011: 18 22. doi:10.4103/2230-8210.77573. PMC 3079864,PMID 21584161.

37.     Auris Nasus Larynx. Egeli E1, Inalkaç E. (1997). growth in relation to tonsillar enlargement Jul;24(3):299-301. Body.

38.     Metin Aydogan a, Demet Toprak a, S¸u¨kru¨ Hatun b, Atilla Yu¨ksel c, Ayse Sevim Gokalp. The effect of recurrent tonsillitis and adenotonsillectomy on growth in childhood.Turkey 2007 International Journal of Pediatric Otorhinolaryngology 71; 2007: 1737—1742.

39.     Jaime Guevara-Aguirre, Priya Balasubramanian, Marco Guevara-Aguirre, Min Wei, Federica Madia, Chia-Wei Cheng, David Hwang, Alejandro Martin-Montalvo, Jannette Saavedra1, Sue Ingles, Rafael de Cabo, Pinchas Cohen, and Valter D.Growth Hormone Receptor Deficiency is Associated With a Major Reduction in Pro-aging Signaling, Cancer and Diabetes in Humans Ecuador McClintock Avenue, Los Angeles, 3(70); 2011: 70 ra13. doi:10.1126/scitranslmed.3001845.

40.     Metin Aydogan a, Demet Toprak a, S¸u¨kru¨ Hatun b, Atilla Yu¨ksel c, Ayse Sevim Gokalp. The effect of recurrent tonsillitis and adenotonsillectomy on growth in childhood.Turkey 2007 International Journal of Pediatric Otorhinolaryngology 71; 2007: 1737-1742.

41.     Seung-Ae Yang. Association study between growth hormone receptor (GHR ) gene polymorphisms and obesity in Korean population. College of Nursing, Sungshin Women’s University, Seoul, Korea 12(6); 2016:632-636.

42.     j. E. Sanchez, e. Perera, l. Baumbach, and w. W. Cleveland. Growth Hormone Receptor Mutations in Children with Idiopathic Short Stature Journal of Clinical Endocrinology and Metabolism Printed in U.S.A. Copyright © by The Endocrine Society. 83 (11); 1998.

43.     Grace A. ‘, D. Vdtch , an , N. Barnes and T. Coles. Recurrent tonsillitis; Growth. Elsevier. International Journal of Pediatric Otorhinolaryngology, 16; 1988: 91-93.

44.     Metin Aydogan a, Demet Toprak a,, S¸u¨kru¨ Hatun b, Atilla Yu¨ksel c, Ayse Sevim Gokalp. The effect of recurrent tonsillitis and adenotonsillectomy on growth in childhood.Turkey 2007 International Journal of Pediatric Otorhinolaryngology 71; 2007: 1737—1742.

45.     Yuval Nachalon, Neta Lowenthal, Sari Greenberg-Dotan, and Aviv D. Goldbart, Inflammation and Growth in Young Children with Obstructive Sleep Apnea Syndrome before and after Adenotonsillectomy; Hindawi Publishing Corporation Mediators of Inflammation 2014, Article ID 146893, 7 pages http://dx.doi.org/10.1155/2014/146893

46.     Primus E. Mullis, Reinhard W. Hollb, Torben LundcvdA, ndree Eblta, Paul M. Brickelld Regulation of human growth hormone-binding protein production by human growth hormone in a hepatoma cell line UK. Molecular and Cellular Endocrinology 18 (1); 1995.

47.     Yuval Nachalon, Neta Lowenthal, Sari Greenberg-Dotan, and Aviv D. Goldbart, Inflammation and Growth in Young Children with Obstructive Sleep Apnea Syndrome before and after Adenotonsillectomy; Hindawi Publishing Corporation Mediators of Inflammation.2014.

48.     A Erman, M Wabitsch and CG Goodyer International Journal of Obesity, 35; 2011: 1520–1529

49.     Alper Koycu a,, Erdinc Aydin a, Sibel Tulgar Kinik b. Changes in body composition and growth pattern after adenotonsillectomy in prepubertal children Ankara 06490, Turkey b Department of Pediatrics, Division of Pediatric Endocrinology, Ankara 06490, Turkey International Journal of Pediatric Otorhinolaryngology 81; 2016: 46–50

50.     A. Grace ‘, D. Vdtch , an , N. Barnes and T. Coles London (U.K.)., 1988) Recurrent tonsillitis and Growth in chikdren International Journal of Pediatric Otorhinola~ngology, 16; 1988: 91-93 Elsevier.

51.     Harilaos S. Vontetsianos, Spiros E. Davris, George D. Christopoulos.Improved somatic growth following adenoidectomy and tonsillectomy in young children. Possible pathogenetic mechanisms, 4(1); 2005:49-54.

52.     Metin Aydogan a, Demet Toprak a, S¸u¨kru¨ Hatun b, The effect of recurrent tonsillitis and adenotonsillectomy on growth in childhood. International Journal of Pediatric Otorhinolaryngology 71; 2007: 1737—1742.

53.     Shitij Arora Manasi Agrawal Murtaza Nazmi N. K. Kapoor P.(2008). Histological study of routine tonsillectomy specimen. Indian J. Otolaryngol. Head Neck Surg. 60; 2008:309–313. DOI: 10.1007/s12070-008-0105

54.     Mogoantă CA1, Ioniţă E, Pirici D, Mitroi M, Anghelina F, Ciolofan S, Pătru E. Chronic tonsillitis: histological and immunohistochemical aspects Rom J Morphol Embryol. 49(3); 2008:381-6.

55.     Agida S Adoga, Danle N Ma`an, Samuel I Nuhu. is routine histopathology of tonsil specimen necessary? African journal pediatric surgery, 8 (3); 2011:283-285.

56.     Carmen aurelia mogoantă, elena ioniţă, d. Pirici, mihaela mitroi, fl. Anghelina, s. Ciolofan, emilia pătru. Chronic tonsillitis: histological animmunohistochemical aspects. Romanian Journal of Morphology and Embryology. 49(3); 2008:381–386

 

 

 

Accepted on 30.08.2018        © RJPT All right reserved

Research J. Pharm. and Tech 2018; 11(12): 5507-5512.