INTRODUCTION:

E.coli is the most prevalent reason for urinary tract infection, which represents 80-90% of all urinary tract infection^1,2,3.E.coli strains appointed to one of the four fundamental groups (A, B1, B2, and D)^4,5, on the basis of the presence of two genes (yjaA and chuA) (yjaA and chuA) and a DNA fractions(TSPE4.C2)^6,7. chuA is an outer membrane protein (heme transport protein)has been found in uropathogenic E.coli.yjaA(encoding presumptive protein), at first, specified for the whole genome sequence of E.coliK-12, and a non-coding region TSPE4.C2^{6, 8}.

Group A and B1 are linked to the commensals strains, while B2 and D groups linked to the extra intestinal strains⁹. Grouping by using PCR technique mentioned by Clermont et al.⁶, which is depended on a triplex PCR for two genes(chuA and yjaA)and unknown DNA fragment TSPE4.C2.

E.coli strains that can cause urinary tract infections called uropathogenic E.coli (UPEC). UPEC isolates comprise various virulence factors that assist habitation and transgression in the urinary system, and to defeat host defenses^10-13.

Adhesive factors (fimbriae) are amongst the important surface virulence factors and pathogenicity determinant of UPEC^14,15; Type 1 fimbriae is the main determinant, that has tendency to receptors of urinary tract. They are composed of repeating major pilin FimA subunits, tip fibrillum (FimF and FimG), and tip adhesion FimH gathered by the chaperone(FimC)-usher (FimD) pathway¹⁶. Thus, FimH is an important adhesion to colonize the different disciplines of E. coli¹⁷. The type 1 fimbriae encourage the existence of bacteria, induce mucosal inflammation, and elevate the infestation and formation of a biofilm^15,18.

P fimbriae (pyelonephritis associated pili) are the second surface virulence factor of UPEC, which is encoded by papgene^19,20. They have a significant function in the pathogenesis of the ascending UTIs and pyelonephritis ¹⁵.

P fimbriae are encoded by the operon of papABCDEFGHIJK. They are consist of different protein subunits involving in the structure of the pilus(major pilin papA, pilus grapnel papH, tip fibrillum papKEF, and apex adhesion papG), pilus assembly (periplasmic chaperone PapD and external membrane guidepapC), and pilus arrangement (PapB and PapI)²¹.

Other virulence factors of UPEC are the secreted virulence genes(toxins); like α-hemolysin (HlyA).The HlyA encoded by hly gene which is played a significant function in the UTIs development. HlyA is a pore forming toxin within the repeats in toxin(RTX) family which is found in gram negative bacteria^15,20.α- haemolysin excreted by uropathogenic E. coli to lyse erythrocytes and renal epithelial cells. Haemolysin production is needed four genes(hlyA, hlyB, hlyC, hlyD).The structural gene of hemolysinencoded by hlyA²².

Uropathogenic-specific protein (usp) is an important virulence factor. In addition, usp is intellected to possesses bacteriocin effectiveness in order to usp has similar activity as nuclease-type bacteriocins. Several studies indicated that uropathegenic specific protein (usp) virulence gene were present in E. coli isolates²³. USP gene is carried by the delusive pathogenicity island (PAI) with three downstream small open reading frames (Imu1-3) is vastly spreaded in UPEC strains^24,
25.

The goal of this research was to reveal the groups of E.coli isolated from patients with UTIs using PCR technique and to determine the existence of some virulence genes such as fimbriae genes (fimH and papC), hemolysin(HlyA), and uropathogen specific protein(UPS) among uropathogenic Escherichia coli.

MATERIALS AND METHODS:

Sample collecting:

Forty urine specimens were collected from cases of urinary tract infections (26 female and 14 male) who were admitted to Al-Diwaniyah Teaching Hospital during the period from 3/2017 to 8/2017.

Bacterial isolation:

Escherchia coli strains was secluded from specimens of urine and identified with criterion biochemical tests and by Vitek system (BioMerieux, USA)^26,27.

Extraction of Bacterial Genomic DNA:

Bacterial genomic DNA was extracted from Escherchia coli isolates by using PrestoTM Mini gDNA Bacteria Kit (Geneaid.USA). One ml of overnight bacterial growth on BHI broth putin 1.5ml microcentrifuge tubes and centrifuged at 10000 rpm for 1 minute. After that, the supernatant was described and the bacterial cells pellets were used in genomic DNA extraction. The extraction has been done according to the company's instructions. Then the concentration of extracted genomic DNA checked by Nanodrop spectrophotometer and then stored in the refrigerator at (-20) until perform PCR assay.

Amplification of virulence genes by Polymerase chain reaction(PCR):

PCR assay was accomplished to reveal predominate genes of virulence factors and phylogenetic groups of uropathogenic lmp(UPEC)by using specific primers designed by Mladin et al.²⁸ and provided by (Bioneer company. Korea).The primers sequences are mentioned in Table(1).

The master mix of PCR was attended via using kit of AccuPower PCR PreMix(Bioneer.Korea). The premix tube of PCr involves freezing –dehydrated pellet of (1U of Taaq DNA polymerase, 250µM dNTPs, 10mM Tris-HCl (pH 9.0).30mM KCl, 1.5mM MgCl2, stabilizer, and tracking dye). The PCR master mix was destined based on manufacturer's instructions in a total volume of 20µl per reaction by added 5µl of purified genomic DNA, 1µl of forward primer(10pmole), 1µl of reverse primer (10 pmole), and thereafter the volume of PCR premix tube completed by deionizer PCR water for 20µl and briefly mixed by vortex centrifuge (Bioneer.Korea). The reaction was accomplished in a thermocycler in (Mygene Bioneer.Korea) through set up the following conditions; initial denaturation temperature of 95°C for 5 min, followed by 30 cycles at denaturation 95°C for 30 s, annealing(PapC: 60°C, usp: 60°C, chuA: 58°C, yjaA: 60°C, TspE4.C2: 60°C, hly: 55°C, and fimH: 60°C) and extension 72°C for 1min and then the definitive extension 72°C for 5 min.The PCR products were examined by electrophoresis in a 1.5% agarose gel, stained with ethidium bromide, and viewed by UV transilluminator (San.Gabriel, USA).

Statistical Tests:

The data statistically qualified in expressions of frequencies (percentages). Whole statical computations were achieved using Microsoft Excel 2007(Microsoft Corporation, New York, USA).

RESULTS AND DISCUSSION:

Isolation:

From a total of 40urine specimens collected from patients (of both gender) with urinary tract infections and culturing on culture media, there was only 34 samples gave positive results for culture, whereas 6 samples give negative results for culture even after 48h.

Identification:

A total of 34 urine specimens gave positive results for bacterial culture, Only 14 isolates (41.17%) were identified as E. coli, whereas the rest 20 isolates (58.82%) belong to other type of bacteria as shown in table (2).

Table 2: Distribution of bacterial isolates from urine specimens

Isolates Name	Pure Isolates	Mix Isolates	Isolates(%)
E. coli	13	1	14(41.17%)
Klebsiella pneumoniae	4		4(11.76%)
Proteus spp.	5		5(14.7)
P.aeruginosa	1	2	3(8.82%)
S. aureus	5	1	6(17.6%)
S. saprophyticus	2		2(5.9%)
Total	30	4	34(100%)

As mentioned in Table(2), 30 cases of urinary tract infections were caused by single bacteria.Whereas, mixed bacterial isolates appeared only in four cases.

Grouping of E.coli isolates:

In order to detect virulence genes(chuA, yjaA and DNA fragment TspE4.C2) in E.coli isolates. PCR has been performed using specific primers for genomic DNA extracted from isolates ofE. coli.PCR productsshowed that most of the isolates were have chuA, yjaA, and TspE4.C2 genes with predicted sizes 279, 211, and 152bp respectively).These results are more clarified in figure (1), (2), and (3) respectively.

Table (2)shows that E.coli isolates have the high prevalence compared to other bacterial species isolated from urine specimens and this fining may be due to the fact that most important pathogen is Escherichia coli, being responsible for 70-95%of community acquired and 50%of hospital acquired urinary tract infections^{29, 30}.Other gram negative bacteria such as Klebsiella and Proteus ; and gram positive such as Staphylococcus saprophyticus are the causative agents for the reminder of community acquired infections.³¹.

Escherchia coli strains are classified into four main groups: extra-intestinal (B2 and D groups) and intestinal (A and B1 groups)³². In this study, ithas been found that all isolates of Escherchia coli were due to anextra-intestinal B2 group based on the genotyping classification of Clermont et al.[6] who are defined these groups by using various associations of the following genes; yjaA :group A, TspE4C2: groupB1, chuA+yjaA+TspE4C2, chuA+yjaA:groupB2, chuA+TspE4C2:groupD.

The chuA gene is a portion of the heme transport locus, that seems to disseminate frequently amongpathogenic E.coli strains.

In this study, the spread of chuA gene in the mostisolates of E.coliprobably be a marker to the importance of iron acquisition in the UPEC pathogenicity³³.

The YjaA gene is an interested in the cellular response of E.coli to cadmium, acid stress, hydrogen peroxide, also implicated in the formation of biofilm³⁴.TspE4.C2 is an anonymous DNA fragment³⁵.

Generality, UPEC involved in several cases of UTIs were supposed to centered widely in group B2^{7,36, 37}.

Uropathogenic E.coli existed within the extra-intestinal pathogenic E.coli(EXPEC), categorized in the first place to the group B2, and to a lesser extent in group D, while the commensal strains represented by the group A and B^{36,38,39,40,41}.

Uropathogenic E.coli (UPEC) strains vary from non-pathogenic E.coli via the production of several virulence factors that promote the capability for colonizing the urinary tract and to establish UTI, including: adhesion factors (type 1 fimbriae, P fimbriae), toxins (cytotoxic necrotizing factor and hemolysin), siderophores (aerobactin), evasion mechanisms of host defense/polysaccharides overlay (group II capsules and biofilm formation), capsules ion uptake system and uropathogenic-specific protein (usp) and other bacterial products which are important in the attachment and colonization in the urogenital system and stay out of the intestine, creating a cytopathic effect^{22,37,42,43,44}.

This finding may be associated with the pathogenesis of an isolated strains according lyadhesionis the main determinant for the pathogenicity⁴⁵.

The beginning of a urinary tract infection outcomes by UPEC that having the capacity to contact the epithelial cells of urinary tract via specific adherence factors including type 1 fimbriae^46,47. Connection to the surface of the urothelium is interpose to adherence of fimH, located at the tip of type 1 fimbriae, that blocks overcome of bacteria through urine in fluxs and the infestation of bacteria begins^47,48,49.

The fimH gene is highly conserved in uropathogenic E.coli isolates which assures its critical role in the colonization of urinary tract^38,41,50,51. FimH is implicated to adherence, infestation, urothelial cells apoptosis and initiates the bladder pathology viaadherence to the uroplakin receptor complex¹⁵.

P fimbriae are the most prevalent virulence factor after type 1 fimbriae in the extra-intestinal E.coli that inclusive groups B2 and D, and are more predominant in uropathogenic E.coli strains^32,39. The papC gene, is fundamental to P fimbriae structure which is necessary for bacterial attachment to uroepithelial cells⁵².

Hemolysin secretion is related to the pathogenic strains of E.coli, particularly that causes UTI²². The role of α-Hemolysin (HlyA) in E. coli pathogenicity of may be due to the lysis of cells by forming pores in the plasma membrane⁵³. It is toxic to a range of host cells in ways that possibly participate to inflammation, damage of tissue and destroyed host defenses⁴³.

HlyA has the ability to lyse the erythrocytes and the nucleated host cells, as a result the extra-intestinal pathogens like UPEC can pass the mucosal barriers, destroy the cells of immune system, also get augmented arrival to host nutrients and iron stores¹⁵.

The usp gene is vastly disseminated in strains of E. coli that causes urinary tract infections as well as the other extra-intestinal infections^54-56. Thus, The usp gene considered to be the epidemiological marker of UPEC⁵⁷.

The high prevalence for the presence of hlyA and fimH genes in this study due to that strains with these genes offered interesting relationship with uropathogenic E. coli⁵⁸.

CONCLUSION:

In conclusion, our study revealed that strains of E.coli have various virulence genes interested in the development of the extra intestinal infectious process, such as adhesins (fimH and papC), haemolysin(hlyA) and uropathogenic specific protein(usp).The virulent strains belonged to the extra-intestinal group B2 were most of the virulence genes.

ACKNOWLEDGMENT:

I am grateful to Biology Department, Science College, Al-Qadisiyah University and Microbiology Department, College of Veterinary, Al-Qadisiyah University. I am so grateful to Prof. Dr. Mohammed S. Abdul-Razaq, Microbiology Department, College of Medicine, Babylon University.

REFERENCES:

1. Abe C.M., Salvador F.A., Falsetti I.N., Vieira M.A., Blanco J., Blanco J.E. et al. Uropathogenic Escherichia coli (UPEC) strains may carry virulence properties of diarrhoeagenic E. coli, FEMS Immunol Med Microbiol., 2008; 52: 397-406.

2. Cheng C.H., TsauY.K., Kuo C.Y., Su L.H., Lin T.Y. Comparison of extended virulence genotypes for bacteria isolated from pediatric patients with urosepsis, acute pyelonephritis, and acute lobar nephronia., Pediatr Infect Dis J., 2010; 29:736-40.

3. MohajeriP., Khademi H., Ebrahimi R., Farahani A., Rezaei M. Frequency distribution of virulence factors in uropathogenic Escherichia coli isolated from Kermanshah in 2011-2012, Int J App Basic Med Res.serial online, 2016; 222(4): 111-6.

4. Gordon D.M. The influence of ecological factors on the distribution and genetic structure of Escherichia coli. In Escherichia coli and Salmonella typhimurium, American Society for Microbiology, 2004.

5. Carlos C., Pires M.M., Stoppe N.C., Hachich E.M., Sato M.I., Gomes T.A., Amaral L.A., Ottoboni L.M.Escherichia coli phylogenetic group determination and its application in the identification of the major animal source of fecal contamination. BMC Microbiol., 2010; 10:161-171.

6. Clermont O., BonacorsiS., Bingen E. Rapid and simple determination of the Escherichia coli phylogenetic group, Appl Environ Microbiol., 2000; 66(10):4555-8.

7. Usein C-R., Grigore L. A., Georgescu R. M., Bãltoiu M.C., Teleman M.D. Phylogenetic background and extra intestinal virulence genotypes of Escherichia coli vaginal strains isolated from adult women Revista Română de Medicină de Laborator., 2011; 19(1): 4.

8. Mokracka J., Koczura R., Jabłońska L., Kaznowski A. Phylogenetic groups, virulence genes and quinolone resistance of integron-bearing Escherichia coli strains isolated from a wastewater treatment plant, Antonie Van Leeuwenhoek.2011; 99(4): 817–824.

9. Derakhshandeh A., FirouziR., Moatamedifar M., Motamedi A., Bahadori M., Naziri Z. Phylogenetic analysis of Escherichia coli strains isolated from human samples. Molecular Biology Research Communications, 2013; 2(4):143-149.

10. Tiba M.R., Yano T., Leite Dda S. Genotypic characterization of virulence factors in Escherichia coli strains from patients with cystitis. Rev Inst Med Trop Sao Paulo, 2008; 50(5):255–60.

11. Ejrnæs K. Bacterial characteristics of importance for recurrent urinary tract infections caused by Escherichia coli. Dan Med Bull, 2011; 58:1–22.

12. Kudinha T., KongF., JohnsonJ., Andrew S., Anderson P., Gilbert, G. Multiplex PCR- based reverse line blot assay for simultaneous detection of 22 virulence genes in uropathogenic Escherichia coli. Appl Environ Microbiol., 2012; 78: 1198–202.

13. Asadi S., Kargar M. , SolhjooK., Najafi A., Ghorbani-Dalini S. The Association of Virulence Determinants of Uropathogenic Escherichia coli with Antibiotic Resistance. Jundishapur J Microbiol., 2014; 7(5): e9936.

14. Nicolle L.E.Uncomplicated urinary tract infection in adults including uncom-plicated pyelonephritis. Urol Clin North Am., 2008; 35: 1–12.

15. Bien J., Sokolova O., Bozko P. Role of Uropathogenic Escherichia coli Virulence Factors in Development of Urinary Tract Infection and Kidney Damage. International Journal of Nephrology, 2012, Volume 2012; Article ID 681473, 15 pages.

16. Sauer F. G., Mulvey M. A., Schilling J. D., Martinez J. J., Hultgren S. J. Bacterial pili: molecular mechanisms of pathogenesis. Curr. Opin. Microbiol., 2000; 3;65-72.

17. Sokurenko E.V., Feldgarden M., Trintchina E., Weissman S.J., AvagyanS., Chattopadhyay, S. et al.Selection footprint in the FimH adhesin shows pathoadaptive niche differentiation in Escherichia coli. Mol Biol Evol. 2004; 21(7):1373–83.

18. Anderson G. G., Palermo J. J., Schilling J. D., Roth R., HeuserJ., Hultgren S. J. “Intracellular bacterial biofilm-like pods in urinary tract infections, ” Science, 2003; 301, 5629: 105–107.

19. Jadhav S., Hussain A., Devi S., Kumar A., Parveen S., Gandham N.et al. Virulence characteristics and genetic affinities of multiple drug resistant uropathogenic Escherichia coli from a semi urban locality in India. PLoS One, 2011;6:e18063.

20. Firoozeh F., SaffariM., Neamati, F., Zibaei M. Detection of virulence genes in Escherichia coli isolated from patients with cystitis and pyelonephritis International Journal of Infectious Diseases, 2014; 29: 219–222.

21. Jacobsen S. M., SticklerD. J. , Mobley H. L. T, ShirtliffM. E. Complicated Catheter-Associated Urinary Tract Infections Due to Escherichia coli and Proteus mirabilisClin Microbiol Rev., 2008; 21(1): 26–59.

22. Slavchev G., Pisareva E., Markova N. Virulence of uropathogenic Escherichia coli Journal of Culture Collections, 2009;6(1): 3-9.

23. Bauer R.J., Zhang L.X., Foxman B., Siitonen A., JantunenM.E., Saxen H., Marrs C.F. Molecular epidemiology of 3 putative virulence genes for Escherichia coli urinary tract infection - usp, iha, and iroN(E coli) J Infect Dis., 2002;185(10):1521–1524.

24. ZawM.T., YamasakiE., YamamotoS., NairG.B., Kawamoto K., Kurazono H., Uropathogenic specific protein gene, highly distributed in extraintestinal uropathogenic Escherichia coli, encodes a new member of H-N-H nuclease superfamily. Gut Pathog. 2013;5:13.

25. ČrnigojM., PodlesekZ., BudičM., Žgur-Bertok, D. The Escherichia coli uropathogenic -specific-protein-associated immunity protein 3 (Imu3) has nucleic acid -binding activity.BMC Microbiol., 2014; 14:16.

26. Pincus D.H. Microbial identification using the Biomerieux VITEK 2 System. Encyclopedia of Rapid Microbiological Methods, 1998; 1-32.

27. MacFaddin J. F. Biochemical tests for identification of medical bacteria. 1^st Ed. Williams and Wilkins. Baltimore, USA., 2000.

28. Mladin C., UseinC.R., ChifiriucM., Palade A., Slavu C.L. et al.Genetic analysis of virulence and pathogenicity features of UPEC isolated from patients with Neurogenic bladder // Romanian Biotechnological Letters, 2009; 14 (6): 4906-4911.

29. Foxman B. The epidemiology of urinary tract infection. Nat Rev Urol.; 2010; 7: 653–660.

30. KövesB.The role of bacterial virulence factors in the clinical course of urinary tract infections. Ph.D. Thesis, 2014; 1:8.

31. Davis N.F. and Flood H.D. The Pathogenesis of Urinary Tract Infections, Clinical Management of Complicated Urinary Tract Infection, Dr. Ahmad Nikibakhsh (Ed.), ISBN, 2011; 978-953-307-393-4.

32. NowrouzianF.L., AdlerberthI., Wold A.E. Enhanced persistence in the colonic microbiota of Escherichia coli strains belonging to phylogenetic group B2: role of virulence factors and adherence to colonic cells. Microbes Infect., 2006;8: 834–840.

33. AbiodunA.O., Olufunke O.A., DunahF.Ch., Oladiran F.Phenotypic Identification and Phylogenetic Characterization of Uropathogenic Escherichia coli in Symptomatic Pregnant Women With Urinary Tract Infections in South-Western Nigeria. International Journal of Biology, 2014; 6(4).

34. GordonD., ClermontO., TolleyH, Denamur E. Assigning Escherichia coli strains to phylogenetic groups: multi-locus sequence typing versus the PCR triplex method. Environ Microbiol., 2008; 10: 2484– 2496.

35. BonacorsiS.P., Clermont O., Tinsley C.Identification of the Escherichia coli chromosome specific for neonatal meningitis associated strains. Infect. Immun., 2000;68: 2096-2101.

36. MorenoE., Johnson J. R., PérezT., Prats G., Kuskowski M. A., Andreu, A. “Structure and urovirulence characteristics of the fecal Escherichia coli population among healthy women, ” Microbes and Infection, 2009; 11 ( 2): 274–280.

37. Skjøt-RasmussenL., Hammerum A. M., Jakobsen L., LesterC. H., Larsen, P., Frimodt-Møller N. Persisting clones of Escherichia coli isolates from recurrent urinary tract infection in men and women. J Med Microbiol., 2011;60: 550-554.

38. Mulvey M. A. “Adhesion and entry of uropathogenic Escherichia coli, ” Cellular Microbiology, 2002; 4(5): 257–271.

39. MorenoE., Andreu A., PigrauC., KuskowskiM. A., Johnson J. R., Prats G.“Relationship between Escherichia coli strains causing acute cystitis in women and the fecal E. coli population of the host, ” Journal of Clinical Microbiology, 2008; 46(8):2529–2534.

40. Hilbert W., PaulishT. E., Mordechai E., Adelson M. E., Trama J. P. “O serogroups, phylogeny, and virulence factors of cervicovaginal and rectal Escherichia coli isolates, ” European Journal of Clinical Microbiology and Infectious Diseases, 2008; 27( 12): 1265–1268.

41. López-Banda D. A., Carrillo-CasasE.M., Leyva-LeyvaM., Orozco-HoyuelG., Manjarrez-Hernández A. H., Arroyo-Escalante S. et al. Identification of Virulence Factors Genes in Escherichia coli Isolates from Women with Urinary Tract Infection in Mexico. BioMed Research International, 2014; Volume 2014, Article ID 959206, 10 pages.

42. Arisoy M., AysevD., EkimM., OzelD., Köse S.K., Ozsoy E.D., Akar N. Detection of virulence factors of Escherichia coli from children by multiplex polymerase chain reaction. Int. J. Clin. Pract., 2006;60: 170- 173.

43. Mittal S., SharmaM., Chaudhary U. Study of virulence factors of uropathogenic Escherichia coli and its antibiotic susceptibility pattern. Indian J Pathol Microbiol., 2014; 57:61-4.

44. Al-Bayati B. M., Glinskaya E. V., NechaevaO. V., Luneva I. O. Genotypic detection of fimH virulence gene in uropahogenic Escherchia coli (UPEC) isolated from urinary tract infection.Известия ДГПУ, 2015; No.3.

45. MartinezJ. J., MulveyM. A., SchillingJ. D., PinknerJ. S., Hultgren S. J. “Type 1 pilus-mediated bacterial invasion of bladder epithelial cells, ” EMBO Journal, 2000;19(12): 2803–2812.

46. KaczmarekA., Budzynska A., Gospodarek E. Prevalence of genes encoding virulence factors among Escherichia coli with K1 antigen and non-K1 E. coli strains. JMed Microbiol., 2012; 61(10):1360–5.

47. HojatiZ., Zamanzad B., Hashemzadeh M., Molaie R., Gholipour A. Detection of FimH Gene in Uropathogenic Escherichia coli Strains Isolated From Patients With Urinary Tract Infection Jundishapur J Microbiol., 2015; 8(2): e17520.

48. Finer, G. and D. Landau, Pathogenesis of urinary tract infections with normal female anatomy. Lancet Infec Dis., 2004;4(10):631–5.

49. Su C. Female lower urinary tract infection. JTUA., 2008; 19:12–20.

50. Guyer D.M., GuntherN.W., Mobley I.V. Secreted proteins and other features specific to uropathogenic Escherichia coli. The Journal of Infectious Diseases, 2001; 183(supplement 1): S32–S35.

51. Antao E-M., Wieler L.H., Ewers C.Adhesive threads of extraintestinal pathogenic Escherichia coli. Gut Pathogens, 2009; 1: article 22.

52. DarkoS.N., NsiahK., Twumasi. Prevalence of papC and usp Virulence Factors in Uropathogenic Escherichia coli Causing Asymptomatic Urinary Tract Infections in Adolescents.British Microbiology Research Journal, 2013;3(3): 423-430.

53. WilesT. J., MulveyM. A.The RTX pore-forming toxin α-hemolysin of uropathogenic Escherichia coli: progress and perspectivesFuture Microbiol., 2013; 8: 73–84.

54. Yamamoto S., NakanoM., Terai A., Yuri K., Nakata K., Nair G.B. et al. The presence of the virulence island containing the usp gene in uropathogenic Escherichia coli is associated with urinary tract infection in an experimental mouse model. J Urol. 2001;165: 1347e51.

55. Rijavec M., Mu¨ller-PremruM., Zakotnik B., Zgur-Bertok D. Virulence factors and biofilm production among Escherichia coli strains causing bacteraemia of urinary tract origin. J Med Microbiol., 2008; 57:1329e34.

56. Ananias M. and Yano T. Serogroups and virulence genotypes of Escherichia coli isolated from patients with sepsis. Braz J Med Biol Res., 2008; 41: 877–883.

57. Lai Y.M., Zaw, M.Th., Shamsudin Sh. B., LinZ. Polymerase chain reaction-restriction fragment length polymorphism method for differentiation of uropathogenic specific protein gene types.J Microbiol Immunol Infect. 2016; 49(4): 591-4.

58. Padilla C., Padilla A., Lobos O. Virulence genes and antimicrobial susceptibility of Escherichia coli taken from women with vaginitis in Talca, Chile. J Infect DevCtries, 2014; 8(3): 265-270.

Received on 01.08.2018 Modified on 16.08.2018

Research J. Pharm. and Tech 2018; 11(12): 5483-5489.

DOI: 10.5958/0974-360X.2018.00999.X

Primer	Sequence (5′-3′)		Amplicon size
*papC*	F	GACGGCTGTACTGCAGGGTGTGGCG	*papC*
	R	ATATCCTTTCTGCAGGGATGCAATA
*usp*	F	CGGCTCTTACATCGGTGCGTTG	*usp*
	R	GACATATCCAGCCAGCGAGTTC
*chuA*	F	GACGAACCAACGGTCAGGAT	*chuA*
	R	TGCCGCCAGTACCAAAGACA
*yjaA*	F	TGAAGTGTCAGGAGACGCTG	*yjaA*
	R	ATGGAGAATGCGTTCCTCAAC
*TSPE4.C2*	F	GAGTAATGTCGGGGCATTCA	*TSPE4.C2*
	R	CGCGCCAACAAAGTATTACG
HlyA	F	AGATTCTTGGGCATGTATCCT	HlyA
	R	TTGCTTTGCAGACTGTAGTGT
fimH	F	GCCAAACGAGTTATTACCCTGTT	fimH
	R	CCTTGATAAACAAAAGTCACGCC