1. INTRODUCTION:

Arsenic contamination has become serious in Asian, European, and the American continents over the past years (Ayotte et al., 2003; Karagas et al., 2002; Mukherjee et al., 2006).Arsenic is produced as a byproduct of smelting, fossil fuel combustion, and pesticide production. Accumulation of arsenic in soil, water, and as airborne particles affects the grains, vegetables and marine organisms (Kurosawa et al., 2008; Smith et al., 2008). Humans are adversely affected by cancers, cardiovascular and neurological diseases on exposure to arsenic which has been revealed by epidemiological studies (Tchounwou et al., 2004).

Transparent quality of Zebra fish embryo’s makes them ideal for screening of developmental abnormalities (Haendel et al., 2004; Lema et al., 2007). During the early life stages the zebra fish embryos are exposed to chemical contaminants, often at high concentrations, to investigate the mechanism of chemical toxicity (Hill et al., 2005).

This strategy has been used to rapidly screen for potential toxicity mechanisms of environmental contaminants such as heavy metals, polycyclic aromatic hydrocarbons and common pesticides (Blechinger et al., 2002; Linbo et al., 2006).

Recently, it is reported that abnormal apoptotic activity was involved in arsenic-induced morphological disruption during early development of a transgenic zebra fish model. Geno-toxicity, cell proliferation, altered DNA repair and DNA methylation have been proposed as potential mechanisms of the arsenic toxicity in cancers (Hughes et al, 2002).

PERP, encoding a trans-membrane protein of the Pmp22 family, is a transcriptional p53 target exclusively upregulated in apoptotic cells. However, its role during normal development had remained largely unclear. Here, we report the isolation and characterization of a zebra fish PERP homolog, Upon over expression in early zebra fish embryos, PERP induces apoptosis.

VEGF, is a single protein produced by cells that stimulates vasculogenesis and angiogenesis. Over expression of VEGF can contribute to diseases(Dong Liang et al, 2001).

To explore the potential developmental toxicity of arsenic and its underlying mechanisms in the early embryonic development the present study uses wild type zebra fish.

2. MATERIALS REQURIED:

2.1 Maintaince of zebra fish:

The wild- type strain used in this study is from Kolathur, Chennai. It originated from a local pet shop and was inbred for several generations. All of the food can be purchased at the pet store. Flake food is provided, but fishes were breed better if live food is given. Brine shrimp larva or live tubifex worms and egg yolk has also been reported to work well. Tap water was allowed to settle at room temperature for several hours. The temperature of the water should be kept between 25ºC and 29ºC. The pH should be kept at around 7.0. The lighting should be kept on daily cycle of 14 hours of light and10 hours of dark for the fish to breed. If the aquarium is kept in a rather quiet dark place, an aquarium light on the top of the tank hooked up to a timer (from Home Depot or Lowes) should be kept. Eggs that looked cloudy white or black are removed using a pipette because those eggs are dead or decaying eggs. Keep the embryos at a temperature between 24 (75ºF) and 32 (90ºF) for optimal development. Zebra fish will hatch from their chorions during the 3rd or 4th day after fertilization. The 'standard' temperature for zebrafish is 28.5ºC.

2.2 Toxicity with sodium arsenite:

In order to determine the effective concentration for the subsequent research, zebrafish embryos were assigned to experimental treatment groups and were either exposed to sodium arsenite (0.1mM, 0.2mM, 0.3mM, 0.4mM, 0.5mM, 0.6mM, 0.7mM, 0.8mM, 0.9mM, 1.0mM, 1.1mM) or subjected to control treatments (egg water only) until 120hpf. The direct observation is performed in the well under the microscope at specific time points. At 6 hour, 12 hour, 18 hour, 36 hour.

2.3 DNA isolation:

The treated embryos were isolated using the high salt method (Ramadas etol). The quality and quantity of DNA was determined by agrose gel electrophorosies.

2.4 SDS page:

SDSPAGE was performed according to the procedure of Laemmli (laemmli UK) using 4 to 15% gradient polyacrylamide mini gels under reducing conditions. The gel was stained with coomassie blue.

2.5 isolation of total RNA:

Total RNA was precipitated from treated zebra fish embryos kept at overnight at -80°C in propan-2-ol, was washed in 70% ethanol, resuspended in diethyl pyrocarbonate treated with water (Biotecx, Houston, TX, U.S.A). By spectrophotometric determination at 260 and 280 nm the purity and yield were assessed, and quality was evaluated by 2% agrose gel electrophorosies. The RNA was then divided into aliqutos and stored at -80°C

2.6 PCR analysis:

A sample containing 1 µl of reverse transcription reaction was amplified in a 25 µl of PCR mixture containing 2microliter of PCR buffer, DNPT 2 µl, oligo dT 2 µl, RNA 2 µland RT enzyme 1 µl. The concentration of reverse transcribed cDNA in the PCR mixture was adjusted to ensure the linear correlation between the template and the product. The hot star procedure was applied using the jump start taq polymerase (sigma; 0.2 unit/µl). Semi quantitative RT-PCR using specific primers for VEGF N PERP were employed to perform the house keeping gene beta actin. The amplification was performed in a thermal cycler (MJ Research USA). The primers used for semi-quantitative RT-PCR analysis of VEGF and PERP are: VEGf: Sense 5’CAACGCGTATCGCAGCATAA3’Antisense5’CATCTTGGCTTTTCACATCTTTCT-3 and PERP : Sense 5’- GTGCTCTACCGTCAACGTCT -3’Antisense5’-ACCCTCGTAGATCTGCTCGT-3. The exponential phase of the PCR cycle number for each gene is carefully determined and used in all semi-quantitative RTPCR analyses. The condition for b-actin in RT-PCR is the same as described in Liang et al. (1998). The PCR products were visualized using agrose gel electrophoresis and the results are documented.

Fig 1: Effect of sodium arsenite induced zebra fish.

Zebrafish embryos were assigned to experimental treatment groups and were exposed to sodium arsenite (0.1mM, 0.2mM, 0.3mM, 0.4mM, 0.5mM, 0.6mM, 0.7mM, 0.8mM, 0.9mM, 1.0mM, 1.1mM) or subjected to control treatments (egg water only) until 120hpf. The direct observation is performed in the well under the microscope at specific time points. At 6 hour12 hour, 18 hour, 36 hour.

3. RESULT:

3.1 Effect of sodium arsenite induced zebra fish embryos

Arsenic was an environmental contaminant. Investigation study of zebra fish embryos for sodium arsenite toxicity at different concentration (0.1mM, 0.2mM, 0.3mM, 0.4mM, 0.5mM, 0.6mM, 0.7mM, 0.8mM, 0.9mM, 1.0mM, 1.1mM) reveal the embryos exposed to lower concentration were not mostly affected whereas reduced survival rate with abnormal development was observed in embryos exposed to high concentration (0.8-0.7mM)

3.2 Effect of sodium arsenite treated zebra fish at DNA level

The isolated DNA from different stages of embryo of zebra fish were isolated and then treated with UV radiation and sodium arsenite for mutational studies. This procedure was carried out by agars gel electrophoresis and fragmentation was found in all the stages, which stands as an evidence for the presence of mild mutation.

Fig 2: DNA isolated for zebrafish embryos.

lane 1- 2 cell normal,2- 2 cell UV,3- 2 cell sodium arsenite,4- 4 cell normal,5- 4 cell UV,6- 4 cell sodium arsenite,7- morale normal,8- morale UV,9- morale sodium arsenite,10-blastula normal,11- blastula UV,12- blastula sodium arsenite.

3.3 RT – PCR analysis of zebra fish perp expression during the embryonic development:

The transcription factor p⁵³plays a crucial role during tumor suppression, and loss of p⁵³ is associated with most human cancer. We investigated the temporal expression pattern of PERP during zebrafish development via RT-PCR. As control,transcripts of the ᵝ-actin housekeeping gene were amplified, PERP transcripts can be detected during all investigated stages. Death of cell takes place due to the overexpression of PERP.

Fig 3 shows the effect of UV light and sodium arsenite on mRNA expression of PERP during the development of zebra fish.

PERP, mRNA expression were no significant changed on 2 cells stage of zebra fish treatment with UV and sodium arsenite .Fig 3.6 shows PERP, mRNA expression were significantly changed on 4 cells, morale and blastula cells stages of zebra fish treatment with UV and sodium arsenite. VEGF mRNA expression were normalized with respective β-actin as an internal control.

3.4 RT – PCR analysis of zebra fish VEGF expression during the embryonic development:

Over expression of VEGF contribute to diseases and can lead to cancer. The temporal expression pattern of VEGF was analyzed by RT-PCR. Thetranscripts are present at every stage of embryonic development that was analyzed. Transcripts of ᵝ-actin, housekeeping gene acts as control

4.CONCLUSION:

Arsenic is an environmental contaminant (Kurosawa et al., 2008; Smith et al., 2008). This work reports the sodium arsenite exposure of the zebra fish embryo, which is a small, cheap, whole-animal model which may replace higher animal models in some areas of bio medical and aquaculture research. The zebra fish (Danio rerio) is often used as a vertebrate research over the past decade. Zebra fish embryos are mostly transparent, which make them ideal for screening for developmental abnormalities (Haendel et al., 2004; Lema et al., 2007). Zebra fish embryos at different developmental stages are obtained by allowing the fishes to breed, for this they are first maintained properly for that, they were kept in tap water with proper temperature and pH, they are fed twice a day, after that they were breeded. Embryos are staged according to (Kimmel et al). We described a series of stages for development of the embryo of the zebra fish, Danio (Brachydanio) rerio treated with sodium arsenite at 2 cell stage, 4 cell stage, morale stage and blastula stage. In order to determine the effective concentration for the subsequent research, zebrafish embryos were assigned to experimental treatment groups and were either exposed to sodium arsenite (0.1mM, 0.2mM, 0.3mM, 0.4mM, 0.5mM, 0.6mM, 0.7mM, 0.8mM, 0.9mM, 1.0mM, 1.1mM)or subjected to control treatments (E3 medium). It was revealed that exposure to low doses of arsenite (<0.8mM) did not significantly affect the embryos survival or cause obvious malformation during the embryonic stages (6-18hpf).

However, exposure to higher concentrations of arsenite (≥0.8mM) reduced survival and caused changes in embryonic development, including delayed hatching, reduced growth. DNA isolation was done and fragments found to see any mutational change. RT-PCR was done for two specific genes, PERP gene - PERP plays an anti-apoptotic role during normal zebrafish development to regulate tissue-specific cell survival. PERP is only required in specific cells of the zebrafish embryo. VEGF is a sub-family of growth factors, to be specific, the platelet-derived growth factor family of cysteine -knot growth factors. They are important signaling proteins involved in both vasculogenesis (the de novo formation of the embryonic circulatory system) and angiogenesis (the growth of blood vessels from pre-existing vasculature).

In conclusion, Embryos exposed to lower arsenite concentrations (i.e.0.1 to 0.7mM) were not mostly get affected and at higher concentration (0.8 to 1.1mM) reduced survival rate with abnormal development, delayed hatching, retarded growth and changed morphology. All of these indicate a possible relationship between arsenic exposure and developmental failure in early embryogenesis. Presence of RT-PCR data for proving the presence of cell survival ability with PERP and Collateral circulation with VEGF gene .Our studies suggest that the negative effects of arsenic on vertebrate embryogenesis are substantial.

5. REFERENCE:

1. Dan Li, Cailing Lu, Ju Wang, Wei Hu, Zongfu Cao, Daguang Sun, Hongfei Xiaa, XuMa., (2009) Developmental mechanisms of arsenite toxicity in zebrafish (Danio rerio) embryos. Aquatic Toxicology 91; 229–237.

2. Hisaoka, K.K., and Battle H.I., (1958) the normal developmental stages of the zebrafish, Brachydunio rerio (Hamilton-Buchanan). J. Morphol. 102:311-323.

3. Kimmel CB, Ballard WW, Kimmel SR, et al., (1995). Stages of embryonic development of the zebrafish. Dev Dyn 1995; 203: 253–310.

4. Tabocova, S., Hunter 3rd, E.S., Gladen, B.C., (1996). Developmental toxicity of inorganic arsenic in whole embryo: culture oxidation state, dose, time, and gestational age dependence. Toxicol. Appl. Pharmacol. 138, 298–307.

5. Ayotte, J.D., Montgomery, D.L., Flanagan, S.M., Robinson, K.W.,(2003). Arsenic in Ground water in eastern New England: occurrence, controls, and human health implications. Environ. Sci. Technol. 37, 2075–2083.

6. Dong Liang, Jenny R Chang, Alvin J Chinb, , Alastair Smith, Christina Kelly, Eric S Weinberg, Ruowen Ge.,(2001) The role of vascular endothelial growth factor (VEGF) in vasculogenesis, angiogenesis, and hematopoiesis in zebrafish development. Mechanisms of development 108; 29-43.

7. Haendel, M.A., Tilton, F., Bailey, G.S., Tanguay, R.L., (2004). Developmental toxicity of the dithiocarbamate pesticide sodium metam in zebrafish. Toxicol. Sci. 81,390–400.

8. Holson, J.F., Stump, D.G., Clevidence, K.J., Knapp, J.F., Farr, C.H., (2000). Evaluation of the prenatal developmental toxicity of orally administered arsenic trioxide in rats. Food Chem. Toxicol. 38, 459–466

9. Karagas, M.R., Stukel, T.A., Tosteson, T.D., (2002). Assessment of cancer risk and environmental levels of arsenic in New Hampshire. Int. J. Hyg. Environ. Health 205, 85–94.

10. Kurosawa, K., Egashira, K., Tani, M., Jahiruddin, M., Moslehuddin, A.Z., Rahman, Z.M., (2008). Groundwater–soil–crop relationship with respect to arsenic contamination in farming villages of Bangladesh-a preliminary study. Environ. Pollute. 156,563–565.

11. Laemmil UK : cleavage of structural protein during the assembly of the head of the bacteriophages T4 nature 1970,227:680-685

12. Tchounwou, P.B., Centeno, J.A., Patlolla, A.K., (2004). Arsenic toxicity, mutagenesis, and carcinogenesis—a health risks assessment and management approach. Mol. Cell Biochem. 255, 47–55.

13. Tisler T, Zagorc-Koncan J., (2002) Acute and chronic toxicity of arsenic to some aquatic organisms. Bull Environ Contam Toxicol 69, 421–429

Received on 16.03.2016 Modified on 04.04.2016

Research J. Pharm. and Tech. 9(4): April, 2016; Page 340-344

DOI: 10.5958/0974-360X.2016.00060.3