Detection of CNA Gene for the Presence of Collagen Adhesion in Clinical Strains of Staphylococcus aureus
S.V. Rupashri1, Dr. P. Gopinath2
1BDS 2nd year, Saveetha Dental College, Chennai.
2Senior Lecturer, Department of Microbiology, Saveetha Dental College, Chennai.
*Corresponding Author E-mail :
ABSTRACT:
S. aureus has the ability to bind specific host matrix proteins. The S.aureus surface proteins (adhesins) that mediate the binding of these proteins iscalled as MSCRAMMs to denote their role as `microbial surface components recognizing adhesive matrix molecules'. Genes encoding SaMSCRAMMs that bind collagen, fibronectin, fibrinogen, elastin and osteopontin have been identified. Unlike the genes encoding other S. aureus MSCRAMMs, the gene encoding the collagen-binding MSCRAMM (cna) is not present in every strain of S. aureus. In this study we have taken 20 clinical isolates of S. aureus and were subjected to antibiotic sensitivity pattern followed by the detection of cna gene by PCR. We have observed total resistance to penicillin followed by other group of drugs. 10% of our strains were found to have cna gene. As we had only limited isolates from restricted samples, it is important to include more number of isolates from especially bone related infections in order to rule out the same.
KEYWORDS : Staphylococcus aureus, CNA Gene, PCR Method.
INTRODUCTION
Staphylococcus aureus has been well-documented as a human as well as animal pathogen.[1]This organism is implicated in different infectious conditions such as furuncles or boils, cellulitis, impetigo, and postoperative wound infections of various sites. It has also been associated with serious and life-threatening infections such as bacteremia, pneumonia, osteomyelitis, acute endocarditis, myocarditis, pericarditis, cerebritis, and meningitis. Moreover, it is connected with toxin-related diseases.[2] The ability of S. aureus to cause various infections is attributed with various virulence genes located on the plasmid or chromosomal DNA. There are about 40 virulence genes that are known to involve in all processes from colonization of the host to nutrition and dissemination.[3]
S. aureus has the ability to bind specific host matrix protein[4]. The S. aureus surface proteins (adhesions) that mediate the binding of these proteins iscalled as MSCRAMMs to denote their role as `microbial surface components recognizing adhesive matrix molecules'[4]. Genes encoding SaMSCRAMMs that bind collagen[5], fibronectin[6], fibrinogen[7], elastin[8] and osteopontin [9]have been identified. Unlike the genes encoding other Sa MSCRAMMs, the gene encoding the collagen-binding MSCRAMM (cna) is not present in every strain of S. aureus [10]. Based on this background, we have taken this objective to detect the cna gene from S. aureus isolates.
MATERIALS AND METHODS:
Bacterial Isolates:
A total of 20 clinical isolates of S. aureus were collected from different clinical specimens of patients attending Saveetha Medical Collage and hospital. They were processed for a battery of standard biochemical tests and confirmed. Isolates were preserved in semisolid trypticase soy medium and stored at 4ºC until further use.
Antibiotic Susceptibility Test:
Antibiotic susceptibility testing was determined for these isolates to the following antibiotics such as penicillin, erythromycin, clindamycin, ciprofloxacin, tetracycline, cotrimoxazole and linezolid. These antibiotics were procured from Himedia, Mumbai. This was performed by Kirby-bauer disc diffusion method as per CLSI guidelines [11]
Detection of CNA Gene in Staphylococcus Aureus:
S. aureus isolates were detected for the presence of cna gene by PCR analysis. Detection of the gene was carried out using primer as depicted in table 1. Bacterial DNA was extracted by boiling lysis method. 1 µL of DNA extract was used as template for PCR reaction. The reaction mixture contained 2mM of Mgcl20.2mM dNTP mix and 0.5µM of cna gene with IU of Taq polymerase (New England Biolabs) in a 1x PCR buffered reaction. A positive control of S. aureus with cna gene was also included in this study. PCR amplification was carried out using thermal cycler (Eppendorf) with the following cycling condition. Initial denaturation at 97oC for 1 min and 35 cycles for 30s, 54oC for 1min and 74o C for 1min, followed by a final extension of 10 min at 72oC. PCR products were resolved in 1.5% agarose gel. A 100bp ladder was including in all the gel analysis.[12]
Table 1: Gene sequence of cna gene
|
Primer |
Primer sequence |
Product Size |
|
CNA |
AAAGCGTTGCCTAGTGGAGA AGTGCCTTCCCAAACCTTTT |
192 bp |
RESULTS:
Sample Wise Distribution of Clinical Isolates of S. aureus: Of 20 clinical isolates of S. aureus, 8/20 (40%) were obtained from pus, 6/20 (30%) were from wound, 4/20 (20%) and 2/20 (10%) were from blood and sputum respectively (Figure 1).
Antibiotic Susceptibility Pattern:
We have observed a varied pattern of sensitivity among one S.aureus isolates. There was complete resistance observed for penicillin(100%), 9/20 (45%)isolates were shown to the resistant to erythromycin, 6/20(30%) were to cotrimoxa-zole, 4/20(20%) were to linezolid followed by 3/20 (15%) were resistant to ciprofloxacin and clindamycin respectively (Table 1).
Table 2: Results of antibiotic susceptibility pattern of S. aureus
|
Antibiotics |
Sensitive (%) |
Intermediate(%) |
Resistant(%) |
|
Penicillin |
0 |
0 |
20(100) |
|
Erythromycin |
14(70) |
4(20) |
2(10) |
|
Clindamycin |
15(75) |
2(10) |
3(15) |
|
Ciprofloxacin |
9(45) |
8(40) |
3(15) |
|
Tetracyclin |
14(70) |
4(20) |
2(10) |
|
Cotrimoxazole |
10(50) |
4(20) |
6(30) |
|
Linezolid |
10(50) |
6(30) |
4(20) |
Figure 2: Representative picture showing antibiotic Sensitivity Pattern of S. Aureus
Result of CNA Gene in Staphylococcus Aureus:
2/20 (10%) clinical isolate of S. aureus were found to have CNA gene.
Figure 3: Representative Gel Picture Shows the Presence of CNA Gene in s. Aureus
L2-100bp ladder; L4-cna gene positive
DISCUSSION AND CONCLUSION:
In our study we found 2/20 (10%) of S. aureus were found to possess cna gene. Similar kind of study conducted by Shukla and coworkers in 2010 and Alli from Nigeria in 2015 have reported 95% and nil positivity of having cna gene respectively. As none of our isolate was isolated from orthopedic or other bone related infections patients, we have detected only lesser percentage of positivity of cna gene in our s. aureus isolates, considering that this gene is associated with bone related infections. To conclude, as we had only limited isolates from restricted samples, it is important to include more number of isolates from especially bone related infections in order to rule out the same.
ACKNOWLEDGMENT:
We thank Dr. Kalyani, Professor and Head of the Department of Microbiology, Saveetha Medical College, Chennai for kindly providing the clinical isolates to carry out our research work.
REFERENCES:
1. Foster TJ. Immune evasion by staphylococci. Nat Rev Microbiol. 3;2005 : 948-58.
2. Dinges MM, Orwin PM, Schlievert PM. Exotoxins of Staphylococcus aureus. Clin Microbiol Rev 13;2000:16-34.
3. Arvidson S, Tegmark K. Regulation of virulence determinants in Staphylococcus aureus. Int J Med Microbiol291;2001:159-70.
4. Patti JM, Allen BL., McGavin MJ, Hook M,. MSCRAMM-mediated adherence of microorganisms to host tissue. Annu. Rev. Microbiol. 48;1994: 585–617.
5. Patti JM, Jonsson H, Guss B, Switalski LM, Wiberg K, Lindberg M, Hook M. Molecular characterization and expression of a gene encoding a Staphylococcus aureus collagen adhesin. J Biol Chem. 267;1992:4766–4772.
6. Signas C, Raucci G, Jonsson K, Lindgren PE, Anantharamaiah GK, Hook M, Lindberg M. Nucleotide sequence of the gene for a fibronectin-binding protein from Staphylococcus aureus: use of this peptide sequence in the synthesis of biologically active peptides. Proc. Natl. Acad. Sci. USA 86,1989: 699–703.
7. Boden MK, Flock JI,. Cloning and characterization of a gene. for a 19 kDa fibrinogen-binding protein from Staphylococcus aureus. Mol. Microbiol. 12,1994: 599–606.
8. Park PW, Rosenbloom J, Abrams WR, Rosenbloom J, Mecham RP,. Molecular cloning and expression of the gene for elastin-binding protein (ebpS) in Staphylococcus aureus. J. Biol.Chem. 271, 1996:15803–15809.
9. Jonsson K, McDevitt D, McGavin MH, Patti JM, Hook M,. Staphylococcus aureus expresses a major histocompatibility-complex class II analog. J. Biol. Chem. 270, 1995:21457–214 60.
10. Gillaspy AF, Pratt FL, Thames MD, Iandolo JJ. Prevalence and chromosomal map location of Staphylococcus aureus adhesin genes. Gene 196, 1997: 249–259.
11. Clinical Laboratory Standards Institute. Performance standards for Antimicrobial Susceptibility Testing: Twenty First Informational Supplement. Wayne, PA: Clinical Laboratory Standards Institute:2001 : CLSI document M100-S21.
12. Arciola CR, Campoccia D, Gamberini S, Baldassarri L, Montanaro L. Prevalence of cna, fnbA and fnbBadhesin genes among Staphylococcus aureus isolates from orthopedic infections associated to different types of implant. FEMS Microbiology Letters 246 ; 2005: 81–86.
Received on 24.06.2016 Modified on 15.07.2016
Accepted on 20.07.2016 © RJPT All right reserved
Research J. Pharm. and Tech 2016; 9(10):1626-1628.
DOI: 10.5958/0974-360X.2016.00324.3