Table 1: General details and clinical features of Patients

S.No	Clinical Features	Y-1	Y-2	Y-3	Y-4	Y-5	Y-6	Y-7	Y-8	Y-9	Controls
1	Age at Reporting (in Years)	32	35	38	30	43	35	36	33	45	31
2	Sex	Male	Male	Male	Male	Male	Male	Male	Male	Male	Male
3	Sperm count	Nil	Nil	Nil	Nil	Nil	Nil	Nil	Nil	Nil	Normal
4	Sperm motility	No	No	No	No	No	No	No	No	No	Normal
5	Smoking	Yes	Yes	Yes	Yes	Yes	Yes	Yes	Yes	no	no
6	Alcohol consumption	Yes	Yes	Yes	Yes	Yes	Yes	Yes	Yes	no	no

This deletion shows that it was caused due to spermatogenic arrest at the primary stages of spermatogenesis. By mapping AZFa deletions in patients, [8] it have been observed that these deletions results in loss of the DFFRY and DBY genes and results in the sertoli cell only (SCO) syndrome, while the cases which were retained by the DBY gene were oligospermic.

From the previous studies of AZFa deletion it was seen that these deletions has most important role in spermatogenesis. Therefore, this study is planned to estimate the frequency of Y chromosome micro-deletion in AZF-A region of 9 azoospermia patients selected from a new geographical and ethnic population from Mangalore and its surroundings.

MATERIALS AND METHODS:

Patients and controls

9 azoospermic men and one control sample were collected from the FRU community health centre Mysore, India, for present study. The age groups of azoospermic men ranged from 30 to 45 years. With the help of an experienced Andrologist at FRU community Hospital, a detailed case history and clinical examination of every patient were carried out. The life style, habits and chemical exposure of the probands were recorded, including smoking habit, alcohol drinking and exposure to toxic chemicals shown in Table 1.

Semen analysis is routinely performed on the male partner of couple coming for infertility treatment. After semen analysis only confirmed Azoospermia cases were included in this study. Blood samples from each azoospermic, control men were collected by the Physicians with the written consent.

Blood sample collection

Blood samples were drawn in EDTA vacutainers from the patients and from the control sample to find the deletion frequency of AZF-A region on Y-chromosome.

DNA extraction:

4 ml of intravenous blood was sampled from all the patients and controls by using EDTA coated vacutainer. The genomic DNA was extracted from peripheral blood [9]. Qualitative analysis of DNA was carried out by 1.5% Agarose Gel Electrophoresis (Fig.1).

PCR Analysis:

The polymerase chain reaction (PCR) based studies for microdeletion of AZF-A region on Y-Chromosome of azoospermic and control men were carried out using STS marker on the long arm of Y chromosome.

Screening for AZF-A region was done using one STS marker. The AZF-A region on Y-chromosome was amplified with (STS marker- Sy84) a pair of primers sequence Forward primer (5’ AGAAGGGTCTGAAAGCAGGT3’), Reverse primer (3’ GCCTACTACCTGGAGGCTTC5’). The PCR product size was 445base pair (bp). The lyophilized primers were ordered and received from the company (Merck, Bangalore). Polymerase chain reaction consisted of 20μl PCR reaction mixture and included 5μl 2x Red mix PCR buffer, 1μl of 2picamol (pm) each forward and reverse primer, 9μl of autoclaved MilliQ water and 4μl 10ng genomic DNA. (Table2) The Red mix 2x PCR reagents was purchased from Synergy Scientific Services (Chennai).

Preparation of PCR Master Mix was presented in Table 2. Each sample was amplified separately in a 0.2 ml thin wall tube using an Applied Biosystems® Veriti® 96-Well Thermal Cycler, USA. A PCR condition used for STS marker was as follows: initial denaturation (95°C for 5 min), subsequent denaturation (94°C for 1min) and extension (72°C for 1 min) The annealing temperatures that were used for Sy84 STS marker was 56°C for 1 minutes and final elongation was (72°C for 10min). PCR conditions are presented in table.3. To confirm the deletion or amplification of PCR product of AZF-A region on Y-chromosome, the PCR products were checked by electrophoresis in a 2% agarose gel containing ethidium bromide (0.5 mg/ml) and the bands visualized under UV illumination and photographed (Fig.2).

Table 2: PCR Master Mix amplification of AZF-A region on Y-Chromosome

Content	Quantity	Total
2X Master Mix-RED	5µl × 10	50µl
Forward Primer	1µl × 10	10µl
Reverse Primer	1µl × 10	10µl
Milli Q Water	9µl × 10	90µl
Total Quantity	16µl × 10	160µl
Template DNA	4µl each+16 µl Master Mix	20 µl

Table 3: PCR Conditions for amplification of AZF-A region on Y-Chromosome

Steps of PCR	Conditions
Initiation	95°c for 5 minutes
Denaturation	95°c for 30 seconds
Annealing (Standardized at)	57°c for 1 minute
Elongation (Initial Extension)	72°c for 1 minute
Final Extension	72°c for 5 minutes
Hold	4°c for 15 minutes

RESULTS:

Y chromosome micro deletion analysis of AZF-A region (using Sy84 STS marker) of 9 azoospermic patients sample revealed that out of 9 cases we have observed AZF-A deletion in 3 samples ( Sample no-2,3 and 8). No deletion was observed in control sample.

Fig.1: Qualitative analysis of extracted DNA of Azoospermia patients on 1.5% Agarose gel electrophoresis

Lane1-SampleY1, Lane2-SampleY2, Lane3-SampleY3, Lane4-SampleY4, Lane5-SampleY5

Fig.2: 2% Agarose gel electrophoresis showing the PCR Amplification of AZF-A region on Y-Chromosome with Sy84 STS marker

Lane1-100bp DNA ladder, Lane2-SampleY1, Lane3-SampleY2, Lane4-SampleY3, Lane5-SampleY4, Lane6-SampleY5, Lane7-SampleY6, Lane8-SampleY7, Lane9-SampleY8, Lane10-SampleY9

DISCUSSION:

PCR technique drives DNA-based molecular markers [10]. sY84 is the STS marker which is associated with the AZFa region on the Y- chromosome. The two candidate genes located in the AZFa region are USP9Y and DBY (DDX3Y). Deletions in the AZFa region that remove both of the candidate genes and results in Sertoli cell–only syndrome which is characterized by the presence of complete Sertoli cells in the testes but a lack of spermatozoa in the ejaculate [11]. The present experiment shows that, sY814 has deletion in 3 samples out of 9 cases of azoospermia cases and no deletion was observed in control sample. DBY gene has a probable role in infertility because it is localized in the testis and is involved in the development of premeiotic germ cell [12]. In one of the previous study showed that deletion in AZFa genes is a high prevalence of deletions specifically removing DBY which is seen in 4.2% of idiopathic testiculopathies cases [13].This result showed that DBY has a crucial role in spermatogenesis and it seems to be a major AZFa candidate gene. Despite the tremendous breakthroughs from the past few years, our knowledge of AZF gene function is still considerably limited. The reasons for this can be ascribed to both technical issues and to the inherent complexity of this biological system. In technical terms, the lack of easily accessible animal models (AZF sequence architectures are only present in some primate lineages) and of in vitro spermatogenic cell lines introduce clear restrictions to a faster development of the field. Additionally, the biological properties of the AZF regions further complicate matters, as attested by the tremendous variability associated to the AZFb and AZFc sequences, as well as the intricate regulation of the corresponding genetic determinants. Clearly, the future research lines to be pursued in this field consist of the full sequencing of AZF diversity across the Y chromosome population and of a more in-depth functional characterization of AZF genes. Both represent considerable challenges that will ultimately yield benefits for a significant fraction of infertile couples. Although it is still too premature to envisage AZF gene therapy approaches, the identification of novel AZF molecular disturbances and their associated phenotypes is of clear importance for the clinical management of these patients.

CONCLUSION:

It is very clear that microdeletions in the AZF region are responsible for spermatogenic failure; further studies are worthwhile to delineate the exact function of the genes present in AZF region and their role in spermatogenesis and fertility. However, causes responsible for azoospermic males are still unknown. Analyzing the remaining azoospermic males with additional Y chromosome STS markers, X chromosome, and autosomal markers may help in identifying the unknown cause for azoospermic individuals [14,15]. In light of this study, we believe that the etiology of male infertility may differ between ethnic populations. Therefore, researchers need to keep this in mind and define the strategies for analyzing infertile samples. This data will be useful for infertility clinics for genetic counseling by advising them to choose a female child in case of Y chromosome deletion and to adopt appropriate methods for assisted reproduction.

LIST OF ABBREVIATIONS:

AZF- Azoospermia factor locus

USP9Y- Ubiquitin –specific protease 9, Y chromosome

DBY- DEAD/H box polypeptide, Y chromosome

PCR- Polymerase chain reaction

STS- Sequence-tagged sites

EDTA- Ethylene Diamine Tetra- acetic acid

ACKNOWLEDGEMENT:

The authors would like to thank the VIT University authorities for providing all the facilities needed for this project and also authors are indebted to patients for providing us with blood samples.

REFERENCES:

1. Balkan M, Tekes S and Gedik A. Cytogenetic and Y chromosome microdeletion screening studies in infertile males with Oligozoospermia and Azoospermia in Southeast Turkey. Journal of Assisted Reproduction and Genetics. 2008; 25: 559-65.

2. Tiepolo L and Zuffardi O. Localization of factors controlling spermatogenesis in the nonfluorescent portion of the human Y chromosome long arm. Human Genetics. 1976; 34(2): 119-24.

3. Briton JC and Haines CJ. Microdeletions on the long arm of the Y chromosome and their association with male-factor infertility. Hong Kong Medical Journal. 2000; 6: 184-9.

4. Gatta V, et al. A new case of Yq microdeletion transmitted from a normal father to two infertile sons. Journal of Medical Genetics. 2002; 39: E27.

5. Kent FM, et al. Defining regions of the Y-chromosome responsible for male infertility and identification of a fourth AZF region (AZFd) by Y chromosome microdeletion detection. Molecular Reproduction and Development. 1999; 53: 27– 41.

6. Krausz C, et al. Double-blind Y chromosome microdeletion analysis in men with known sperm parameters and reproductive hormone profiles: microdeletions are specific for spermatogenic failure. The Journal of Clinical Endocrinology and Metabolism. 2001; 86: 2638-42.

7. Kihaile PE, Yasui A and Shuto Y. Prospective assessment of Y-chromosome microdeletions and reproductive outcomes among infertile couples of Japanese and African origin. Journal of Experimental & Clinical Assisted Reproduction. 2005; 2: 9.

8. Sargent CA, et al. The critical region of overlap defining the AZFa male infertility interval of proximal Yq contains three transcribed sequences. Journal of Medical Genetics. 1999; 36: 670-7.

9. Gill P, et al. An evaluation of DNA fingerprinting for forensic purposes. Electrophoresis. 1987; 8: 38-44.

10. Elham Konar, et al. Y chromosome Microdeletions in Idiopathic Infertility in the Khuzestan Province, Iran. Life Science Journal. 2013; 10: 6s.

11. Sun C, et al. Deletion of Azoospermic factor a (AZFa) of Human Y chromosome caused by recombination between HERV15 proviruses. Human Molecular Genetics. 2000; 9(15): 2291-6.

12. Behulova R, et al. DNA analysis of Y-chromosomal AZF region in Slovak population with fertility disorders. Bratislavské lekárske listy. 2011; 112(4): 183-7. Slovak.

13. Carlo Foresta, Ferlin A, Moro E. Deletion and Expression Analysis of AZFa genes on the human Y chromosome revealed a major role for DBY in male infertility. Human Molecular Genetics. 2000; 8(9): 1161-9.

14. Brandell RA, et al. AZFb deletions predict the absence of spermatozoa with testicular sperm extraction: preliminary report of a prognostic genetic test. Human Reproduction. 1998; 13: 2812-5.

15. Wang PJ, et al. An abundance of X-linked genes expressed in spermatogonia. Nature Genetics. 2001; 27: 422–6.