Diagnosis of Human Papillomavirus in Colorectal Cancer and Inhibition by Gamma Radiation

 

Dr. Fadyia Mahdi Muslim Alameedy

Assistant Professor, Department of Laboratory Investigation, Faculty of Science, Kufa University, Najaf, Iraq

*Corresponding Author E-mail: fadyiam.alameedy@uokufa.edu.iq, fadyiamahdi@yahoo.com

 

ABSTRACT:

Human Papillomavirus was is olated from different age groups from 40 upto 71 years for both gender. The samples were diagnosed by RT-PCR. Positive cases of human Papillomavirus were forty represent (63.49%) and twenty two represent (36.50%) negative cases. Isolation process of Human Papilloma virus was successfully performed on chicken embryo fibroblast cell culture for 4th passage for suspected samples obtained from (colon organ) as well as isolate from chick embryo [specific pathogen free (SPF). It was found that at the tissue culture infective dosage (TCID50 /0.1 ml) was (107.8) of virus. The gamma irradiation that dosage used for inactivating of the purified virus which was extracted from allantoic fluid and tissue culture was (6.594) mSv/h. This revision intended to gauge the prevalence of HPV cannon and viral incorporation in colorectal tissues in imperative to estimate its presumed role in colorectal cancer and inhibition viral by gamma radiation.

 

KEYWORDS: HPV, RT-PCR, TCID50, SPF.

 

 


1.    INTRODUCTION:

Colorectal cancer was one of the greatest collective malignancies worldwide [1]. Human papillomavirus impurity has remained attendant with gentle (warts) [2], and malignant genitals, [3] with rectal cancer through large cohort. [4-7]

 

A cancer was the jarring growing of cells been the capacity to attack or extent to other fragments of the body.[9] Signs and symptoms may contain (blood in the stool, a change in bowel movements, weight loss, and feeling tired all the time). [8]

 

Best colorectal cancers were as a result of lifestyle factors and old age with merely a few total of samples by reason of essential hereditary syndromes. Various menace agents consist of (diet, obesity, smoking, and lack of physical activity). Dietary factors that enhance the danger other reasons. An added danger aspect was inflammatory bowel disease, which include (ulcerative colitis and Crohn's disease).

 

Several of the hereditary genetic disorder that be able to reason colorectal cancer comprise (hereditary non-polyposis colon cancer; familial adenomatous polyposis and; conversely, these be a symbol of fewer than five hander of case. It general start as a benign tumor, frequently of variety a polyp, which more time become cancerous. [9,10]

 

Amongst viruses, (HPV) was the most widespread, with over 180 strains, 40 of which were frankly linked to anogenital infections. Human papillomavirus was a minor, non-shroud deoxyribonucleic acid (DNA) virus that infect mucosal cells or skin. The spherical, double-stranded viral genome was around eight-kb in length. The genome encodes for six premature proteins thorough for virus imitation and two twilight proteins, L1 and L2, which were the viral basic proteins.[10]

 

Curative employment for colorectal cancer may involve several confederation of targeted therapy surgical treatment, chemotherapy and radioactivity remedy.[11]

 

2. MATERIAL AND METHODS:

2.1 Samples Collection and Isolation of Human Papillomavirus:

This search was isolated of Human Papillomavirus during a period unlimited beginning 20 May until 10 from September 2017. Forty (30 (75%) males and 10 (25%) females) with non normal patients in age ranged ranged forty to seventy one years of specimens were arbitrarily. All cases were arranged accept to [12].

 

The protected culture was reserved in a rocker for thirty min. At the finish of thirty min dulbecco’s minimal important medium complemented with 1 per cent foetal calf serum was additional. The cultures were gestated at 37oC.

 

2.2 Diagnosis of Human Papillomavirus:

Real-time PCR used to detect HPV-DNA, the primer design by NCBI and optimase protocol, viral DNA kit (Cat.Number:INFA0290, Nova Tec, Germany)

 


 

Table (1): Detection primers of human depended to NCBI

Type/subtype

Gene

Name

Sequences

Bases

PCR product size

HPV type 16

E2

Primer_4_F

CCCTGCCACACCACTAAGTT

20 bp

218 bp

Primer_4_R

GTCCAATGCCATGTAGACGA

20 bp


 

2.3 Preparation of cell culture, virus isolation and Virus titration on CEF cell culture:

It was performed according to Moresco et al., (2010). It was performed according to OIE, (2009). This test was performed according to Frey and Liess, (1971).

 

2.4 Inhibition by gamma ray:

The virus was exposed to 4000 ergs per cm2 for 45 min at 4 oC using gamma radiation including cobalt60Co source. The carried and absorbed dose were calculated according to Knoll, (1979).

 

3 RESULTS:

3.1. Real Time PCR:

Of a total 63 suspected of virus infected cases only 40 positive case were detected as Human Papillomavirus infected with RT-PCR. Thirty cases of Males infected consider the highest of females. Age group (61-71 years) more than age groups for study in figure (1,2,3,4).

 

 

Figure (1) Preparing positive and negative cases of Human Papillomavirus

 

 

Figure (2) Indicating the numbers of males and females infected of Human Papillomavirus

 

 

Figure (3) Percentage of age groups affected

 

A: positive case

 

B: negative case

Figure (4) Diagnosis of Human Papillomavirus by RT-PCR

3.2 Inhibition of virus

The changes of cytopathic were observed after 24 hours before and after inhibition, showed rally and hole while cobalt was used, there were no changes compared with the virus infected cells and similar of control group. This indicates the ability of the element used to inhibit of virus in figure (5).

 

Figure (5) CPE of CEF (B), (C) after gamma ray and (A) control of Chicken Embryo Fibroblast Cell Culture.

 

4. DISCUSSION:

The first study in Iraq to diagnose of human Papillomavirus type 16 (E2) gene from the member who was removed from the patient during the operation of the surgical procedure was taken and diagnosed through the primers were designed through the site (NCBI) by RT-PCR technique which resembled with the (Kleter et al., 2005 and Sohrab et al., 2005) from where use the method of diagnosis. The results of the study appear that the incidence of males higher than females Corresponds to the study (Andrea et al., 2011 ), and for the age group (61-71 years) show up the highest incidence of the virus, while study (Brenneret al., 2007) the age group was (55-59 years) of women were 5.6% and males were lowest percentage 5.1%, while a report of [20], showed the incidence of colon cancer in the category (15-49 years) is the most affected but the lowest proportion of other orargans. A study (Damin et al., 2013) included 8 studies about colorectal carcinomas showed a rise in South America (60.8%) compared with Europe (31.9%), as well as the virus often exists in Asia was percentage (73.34%). Cytophatic changes, only the study of the world (Gresser et al.,1965) was similar to the changes, but the inhibition of virus through gamma radiation using the cobalt element was not used in the studies and was relied upon by the research that we have done and observed the effect of cobalt in the viruses studied in our research is published by us.

5. REFERENCES:

1.     Sankaranarayanan R, Swaminathan R, Brenner H, Chen K, Chia KS, Chen JG, et al. Cancer survival in Africa, Asia, and Central America: a population-based study. Lancet Oncology. 2010, 11:165–173.

2.     Kraut AA, Schink T, Schulze-Rath R, Mikolajczyk RT, Garbe E. Incidence of anogenital warts in Germany: a population-based cohort study. BMC Infect Dis. 2010, 10:360.

3.     Hemminki K, Li X, Vaittinen P. Time trends in the incidence of cervical and other genital squamous cell carcinomas and adenocarcinomas in Sweden, 1958-1996. Eur J Obstet Gynecol Reprod Biol. 2002, 101:64–69.

4.     Wilkinson JR, Morris EJ, Downing A, Finan PJ, Aravani A, Thomas JD, et al. The rising incidence of anal cancer in England 1990-2010: a population-based study. Colorectal dis. 2014, 16: O234–O239.

5.     Petersen I, Klein F. HPV in non-gynecological tumors. Pathologe. 2008, 29:118–122. German.

6.     Erol D, Bulut Y, Yuce H, Ozercan IH. Investigation of the presence of human papillomavirus DNA in various gastrointestinal carcinoma samples. Mikrobiyol Bul. 2009, 43:259–268. Turkish.

7.     Mlynarczyk B, Malejczyk M, Muszynski J, Majewski S. The occurrence of human papillomavirus--HPV in the biopsies from colon polyps and cancer. Med Dosw Mikrobiol. 2009, 61:191–196. Polish.

8.     General Information About Colon Cancer. NCI. May 12, 2014. Archived from the original on July 4, 2014. Retrieved June 29, 2014.

9.     World Cancer Report 2014. World Health Organization. 2014. pp. Chapter 5.5. ISBN 9283204298.

10.   Colorectal Cancer Prevention. National Cancer Institute. February 27, 2014. Archived from the original on July 5, 2014. Retrieved June 29, 2014.

11.   Colon Cancer Treatment. NCI. May 12, 2014. Archived from the original on July 5, 2014. Retrieved June 29, 2014.

12.   OIE." Avian influenza. Chapter 2.3.4". OIE (world Organization for animal health

13.   Terrestrial Manual. Pp:43-56; 78-89; 143-146. (2009). Moresco, K. A., Stallknecht, D. E. and Swayne, D. E. "Evaluation and Attempted Optimization of Avian Embryos and Cell Culture Methods for Efficient Isolation and Propagation of Low Pathogenicity Avian Influenza Viruses" Avian Diseases Digest, vol. 5, no. s1, p. e142 -e143(2010).

14.   Frey, H.R. and Liess, B." Growth Curve Studies and Applicability of Highly Cytopathogenic BVD-MD Virus Strain for Diagnosis Purposes Using Microtiter Method". ZBL. Vet. Med. 18:16-71. (1971).

15.   Knoll, G. F. (1979). Radiation Detection and Measurement (John Wiley& Sons, New York, Pp35-37.

16.   Kleter, B. Quint, W. Molijn, A and Doorn,L. Molecular diagnosis of human papillomavirus (HPV) infections Journal of Clinical Virology 32S (2005) S43–S51

17.   Sohrab, B., Koji ,Y. Shu,Y. Maria, D. Joel ,M.  and Zhi-Ming Z. Colorectal papillomavirus infection in colorectal cancer patients. Clin Cancer Res. 2005 Apr 15; 11(8): 2862–2867.

18.   Andrea, N. Polly, A. Margaret, T. Denise, A.  Margaret, M. Michelle, A. Joseph, J. Karen, W. John, D. and Stephen, M. No evidence for human papillomavirus in the etiology of colorectal polyps. Cancer Epidemiol Biomarkers Prev. 2011 Oct; 20(10): 2288–2297.

19.   Brenner H, Hoffmeister M, Stegmaier C, Brenner G, Altenhofen L, Haug U. Risk of progression of advanced adenomas to colorectal cancer by age and sex: estimates based on 840,149 screening colonoscopies. Gut. 2007;56(11):1585–1589.

20.   Damin, D. Ziegelmann, P and Damin, A. Human papilloma virus infection and colorectal cancer risk: a meta-analysis. Colorectal Disease Volume 15, Issue 8, Version of Record online: 29 AUG 2013.

21.   Gresser, I. Chany, C and Enders, J. Persistent Polioviral Infection of Intact Human Amniotic Membrane Without Apparent Cytopathic Effect. Journal of Bacteriology, Feb., 1965. American Society for Microbiology Vol. 89, No. 2 Printed in U.S.A.

 

 

 

 

Received on 05.10.2018          Modified on 19.11.2018

Accepted on 26.12.2018        © RJPT All right reserved

Research J. Pharm. and Tech. 2019; 12(5):2182-2184.

DOI: 10.5958/0974-360X.2019.00363.9